upd table

docs/kill-switch.md

@@ -16,9 +16,10 @@ The Natronaut team intends to implement the kill switch once the testing phase o
 
 It is important to point out the relevance of the **wavelength** chosen to trigger the antitoxin. Blue light is the type of visible light with the shortest wavelength, and thus, it carries the highest energy. This is relevant because blue light is able to penetrate deeper into the water layer that will surround Natronaut in case of a leak.
 
-| Kill Switch | BioBrick Name | Sequence | Link |
-|---------------|-------------------|-----------|----------|----------------------------------------------|--------------|--------|------------|
-| [Wild type plac-FixK2 hybrid promoter](https://parts.igem.org/Part:BBa_K1913025) | BBa_K1913025 | <span class="bubble"> ggcagtgagcgcaacgcaattccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcataattgtgagcggataacaattggaga </span>|
+| BioBrick Part | Name | 
+|---------------|-------------------|
+| [BBa_K1913025](https://parts.igem.org/Part:BBa_K1913025) | Wild type plac-FixK2 hybrid promoter | 
+
 
 <style>
   body {