upd table - change back

docs/kill-switch.md

@@ -16,14 +16,14 @@ The Natronaut team intends to implement the kill switch once the testing phase o
 
 It is important to point out the relevance of the **wavelength** chosen to trigger the antitoxin. Blue light is the type of visible light with the shortest wavelength, and thus, it carries the highest energy. This is relevant because blue light is able to penetrate deeper into the water layer that will surround Natronaut in case of a leak.
 
-| BioBrick Part | Name | Sequence |
-|---------------|-------------------|--------------------------------|
-| [BBa_K1913025](https://parts.igem.org/Part:BBa_K1913025) | Wild type plac-FixK2 hybrid promoter | <span class="bubble">ggcagtgagcgcaacgcaattccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcataattgtgagcggataacaattggaga</span> |
+| BioBrick Part | Name | 
+|---------------|-------------------|
+| [BBa_K1913025](https://parts.igem.org/Part:BBa_K1913025) | Wild type plac-FixK2 hybrid promoter | 
+
 
 <style>
   body {
     font-family: Arial, sans-serif;
-    background-color: #f4f8fc; /* Softer background */
   }
 
   table {
@@ -31,44 +31,46 @@ It is important to point out the relevance of the **wavelength** chosen to trigg
     border-collapse: collapse;
     border-radius: 10px;
     overflow: hidden;
-    box-shadow: 0 2px 10px rgba(0, 0, 0, 0.05); /* Softer shadow */
+    box-shadow: 0 0 10px rgba(0, 0, 0, 0.1);
   }
 
   th {
-    padding: 14px;
-    background-color: #8babf1; /* Light header color */
-    color: #333333; /* Darker text for contrast */
-    text-align: center;
-    border: 1px solid #d9eaf8; /* Light border for header */
+    padding: 12px;
+    background-color: #0073e6; /* Darker shade for the header */
+    color: #ffffff; /* White text for contrast */
+    border: 2px solid #00bf7d; /* Dark border around header */
+  }
+
+  th, td {
+    padding: 10px;
+    text-align: left;
+    border: 2px solid #00bf7d; /* Dark border for separation */
   }
 
   td {
-    padding: 12px;
-    background-color: #e9f0fc; /* Lighter background for cells */
-    color: #333333; /* Dark text for readability */
-    text-align: center;
-    border: 1px solid #d9eaf8; /* Light border for cells */
+    background-color: #b3c7f7; /* Light background for readability */
+    color: #1c2740; /* Dark text for visibility */
   }
 
   tbody tr:hover {
-    background-color: #d9eaf8; /* Slight hover effect */
+    background-color: #00b4c5; /* Highlight on hover for interactivity */
+    color: #1c2740; /* Keep text dark for visibility */
   }
 
   tbody tr:nth-child(odd) {
-    background-color: #f2f6fd; /* Lighter background for odd rows */
+    background-color: #8babf1; /* Slightly darker for odd rows */
   }
 
   .bubble {
     display: inline-block;
-    background-color: #e6f7f1; /* Lighter bubble color */
-    color: #333333; /* Darker text for visibility */
+    background-color: #00bf7d; /* Bubble color */
+    color: #1c2740; /* Dark text for visibility */
     padding: 5px 10px;
     border-radius: 15px;
+    margin: 0 2px;
     font-size: 0.9em;
-    font-family: 'Courier New', Courier, monospace; /* Monospace font for sequence */
   }
 </style>
 
 
 
-