Merge branch 'main' of ssh://gitlab.igem.org/2024/bielefeld-cebitec

src/components/Table.tsx

 import { Part } from "../data/parts";
+import { Res } from "../data/results-table";
 
 export function PartTable({data, cols}: {data: Array<Part>, cols: Array<string>}){
     let list: JSX.Element[]  = [];
@@ -37,4 +38,45 @@ export function PartTable({data, cols}: {data: Array<Part>, cols: Array<string>}
      </div>
    </div>
     )
+}
+
+
+
+export function ResTable({data, cols}: {data: Array<Res>, cols: Array<string>}){
+  let list: JSX.Element[]  = [];
+  for (let index = 0; index < data.length; index++) {
+      list.push(
+          <tr>
+              <td>{data[index].nr}</td>
+              <td>{data[index].silent}</td>
+              <td>{data[index].pbs}</td>
+              <td>{data[index].att}</td>
+              <td>{data[index].q1}</td>
+          </tr>
+      )
+  }
+  let heads: JSX.Element[]  = []; 
+  for (let index = 0; index < cols.length; index++) {
+      heads.push(<td><b>{cols[index]}</b></td>)
+  }
+  return(
+      <div className="flex flex-col">
+   <div className="min-w-full overflow-x-auto">
+     <div className="inline-block min-w-full py-4">
+       <div className="overflow-hidden p-2">
+         <table className="text-center restable">
+           <thead className="bg-d">
+              <tr>
+                  {heads}
+              </tr>
+           </thead>
+           <tbody>
+              {list}
+           </tbody>
+         </table>
+       </div>
+     </div>
+   </div>
+ </div>
+  )
 }
\ No newline at end of file

src/contents/Contribution/PartCon.tsx

+import { H4 } from "../../components/Headings";
+import { PDF } from "../../components/Pdfs";
+import { Subesction } from "../../components/sections";
+
+export function PartContribution(){
+
+    return(
+
+        <Subesction title="Parts" id="Our Contributions2">
+              <H4 text="Our Protocol Collection"/>
+              <PDF link="https://static.igem.wiki/teams/5247/pdfs/protocol-collection-igem-2024.pdf" name="protocol-collection-igem-2024.pdf"/>
+              <p>ShapeOur contribution includes an extensive collection of optimized protocols designed to provide future iGEM teams with easy-to-use starting materials. We've refined these protocols and compiled them into comprehensive summaries, incorporating our experiences, tips, and tricks to make synthetic biology more accessible and enjoyable, especially for newer iGEM teams. Additionally, we have integrated safety and security standards into the protocols, making it easier to introduce the handling of human biomaterials in the iGEM competition while ensuring compliance with necessary regulations. This collection is intended to streamline the workflow and empower teams to approach their projects with greater confidence. </p>
+              <H4 text="Our Reporter System PreCL"/>
+              <p>To effectively test different Prime Editing systems and pegRNAs targeting the CF-specific genomic mutation (delF508), we developed a highly sensitive reporter system called PreCL (Prime Editing Conceptualizable Light). This system is designed to detect fluorescence signals across a variety of devices, offering flexibility in measurement and ensuring reliable, high-quality results. </p>
+              <p>PreCL is characterized by its high sensitivity, with minimal background noise, allowing for precise and accurate detection. Additionally, it closely mimics the CF genomic context, making it highly relevant for CF-specific research. The system features an easy-to-read output, simplifying the interpretation of experimental data, and is designed for constitutive performance, ensuring consistency across tests. </p>
+              <p>One of the standout features of PreCL is its modular design, which allows it to be adapted to different genomic contexts, extending its utility beyond CF research. While it is optimized for Prime Editing, it also has potential applications for broader genetic approaches such as CRISPR/Cas and base editing. With these advantages, PreCL offers a powerful and versatile tool that facilitates testing and enhances the precision and efficiency of genetic research. </p>
+              <img src="https://static.igem.wiki/teams/5247/engineering-cycle/precl.svg"/>
+              <H4 text="Our pegRNA Architecture"/>
+              <p>In our research, we optimized the structure of pegRNAs to develop a stable and efficient variant with enhanced sensitivity. By incorporating the novel RNA structural motif TevoPreQ1, we improved the stability and complex formation of the pegRNA, ensuring higher Prime Editing throughput. Additionally, we introduced silent edits to promote mismatch repair, further boosting Prime Editing efficiency. By fine-tuning the length of the Reverse Transcriptase Template and Primer Binding Sequence, we ensured optimal pegRNA performance, maximizing editing efficiency. </p>
+            <p><small>5‘TCTGTATCTATATTCATCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGATATGTTCAGGTAAGTGTGTCATACGATGAATATAGATACAGCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTT3‘ </small></p>
+                <H4 text="Our Prime Editing Technology PrimeGuide "/>
+                <div className="row">
+                    <div className="col">
+                        <img src="https://static.igem.wiki/teams/5247/engineering-cycle/pecomplex.svg"/>
+                    </div>
+                    <div className="col">
+                        <p>We developed a groundbreaking Prime Editing system designed to overcome current limitations in genome editing. As part of this innovation, we introduced a novel eukaryotic RNA-binding DNA-nickase protein, created through enzyme engineering. This protein serves as a much smaller alternative to the traditional Cas9, making it easier to use in Prime Editing and other genetic applications. </p>
+                    </div>
+                </div>
+                <p>Additionally, we implemented significant improvements, such as a more efficient Reverse Transcriptase and optimized RNA-binding proteins, which together enhance the overall efficiency of the Prime Editing complex while minimizing off-target effects. </p>
+
+                <div className="row">
+                    <div className="col">
+                        <img src="https://static.igem.wiki/teams/5247/engineering-cycle/primeguide-logo.svg"/>
+                    </div>
+                    <div className="col">
+                        <p>By contributing this advancement, we enable safer and more precise Prime Editing for correcting genetic mutations. Our composite part is versatile and can be applied to various contexts, offering immense value to the synthetic biology community. This contribution not only enhances Prime Editing technologies but also provides future researchers with more robust tools for their genetic engineering endeavors. </p>
+                    </div>
+                </div>
+                <H4 text="Our Lipid Nanoparticle AirBuddy "/>
+                <img src="https://static.igem.wiki/teams/5247/engineering-cycle/airbuddy-overview.svg"/>
+                <p>Our innovative delivery system enables the lung-specific transport of RNA and DNA molecules into eukaryotic cells, offering a significant advancement for gene therapies targeting lung diseases. This formulation overcomes the limitations of current delivery strategies by providing an advanced dry powder inhalation technology designed for controlled monthly use and cost-effective long-term storage, making it highly practical for sustained treatments. </p>
+                <p>The delivery system stands out for its low cytotoxicity compared to traditional methods like DEMPEG, ensuring a safer application. Its positively charged formulation is optimized for the efficient binding and transport of negatively charged lung cells, enhancing cargo delivery. The system's ideal size distribution further promotes efficient cellular uptake, resulting in significantly higher transfection rates compared to standard reagents like Lipofectamine. </p>
+                <p>Moreover, its lung-specific design makes it particularly suitable for treating various lung-specific diseases, while its sphere-like structures ensure excellent stability for use in dry powder inhalation therapies. This breakthrough in delivery technology provides a safer, more efficient, and cost-effective solution for delivering genetic material to target cells, with the potential to revolutionize lung disease treatments. </p>
+                
+          </Subesction>
+    )
+}
\ No newline at end of file

src/contents/Contribution/Wiki/Wiki-downloads.tsx

+import { H4 } from "../../../components/Headings";
+import { TwoLinePDF } from "../../../components/Pdfs";
+
+export function WikiDown(){
+
+    return(
+    <>
+        <div className="col cycletab" id="flyers" style={{display: "block"}}>
+            <div className='row align-items-center'>
+                <div className='col'>
+                <H4 text="Our List"/>
+                <TwoLinePDF link='' name=""/>
+                </div>
+                <div className='seperator-2 col-2'>
+                </div>
+                <div className='col'>
+                <H4 text="Our List"/>
+                <TwoLinePDF link='https://static.igem.wiki/teams/5247/pdfs/vokabelliste-wiki.pdf' name="vokabelliste-wiki.pdf"/>
+                </div>
+            </div>
+        </div>
+    </>
+    )
+}
\ No newline at end of file

src/contents/Contribution/collabs.tsx

@@ -9,6 +9,7 @@ export function CollabContribution(){
     
     return(
         <Subesction title="LNP Handbook" id="Our Collaborations2">
+            <p>In collaboration with the iGEM teams Linkoping, Patras, Radboud-University and TERMOSZ-Selye-HUN, we contributed a comprehensive overview of lipid-based delivery systems. Our contribution to the handbook aims to provide future iGEM teams with a deeper understanding of LNP (Lipid Nanoparticle) development. By bringing together diverse teams and innovative solutions, we strive to make a positive impact on the emerging field of LNP design. Our goal is to enhance the accessibility of various LNP formulations and adapt this promising technology for a wide range of therapeutic applications. </p>
             <p>Download our LNP Hanbook that was created in <a onClick={() => goToPagesAndOpenTab('colls2024', '/human-practices')}>cooperation</a>  with the team <a href="https://2024.igem.wiki/linkoping/">Linköping</a>.</p>
             <PDF link="https://static.igem.wiki/teams/5247/pdfs/liposomes-handbook.pdf" name="liposomes-handbook.pdf"/>
         </Subesction>

src/contents/Contribution/contribution.tsx

@@ -19,16 +19,17 @@ export function Contribution() {
 
       <Section title="Our Collaborations" id="Our Collaborations">
         <Subesction title="MeetUp Guideline" id="Our Collaborations1">
-            <GuidePDF/>
+              <GuidePDF/>
+              <p>In cooperation with the iGEM teams Hamburg and Frankfurt, we have developed a comprehensive guideline for the organization of a meet-up. This guideline serves as a template for other iGEM teams and provides a complete overview of all essential aspects that should be considered when planning and organizing a successful meet-up. It covers all the necessary content, from initial brainstorming to practical implementation, and is designed to help teams organize their own events smoothly. </p>
+              <p>Additionally, in collaboration with iGEM Münster, we created a video podcast that summarizes the developments and feedback from the participating teams and reflects on both Meet-ups. It was particularly interesting to observe the growth of the team members and the progress of their projects. The video podcast will be featured on the Wiki page of Team Münster and will also be included here after the Wiki freeze. </p>
+           
         </Subesction> 
         <CollabContribution/>
       </Section>
       
       <Section title="Our Contributions" id="Our Contributions">
           <SafetyContribution/>
-          <Subesction title="Parts" id="Our Contributions2">
-              ...
-          </Subesction>
+          
           <Wiki/>
       </Section>
       <Section title="Conclusion" id="Conclusion">

src/contents/Contribution/safety-contribution.tsx

@@ -10,8 +10,15 @@ export function SafetyContribution(){
        <>
         <Subesction title="Biosafety & Security" id="Our Contributions1" >
             <H4 text="Primary Culture Safety Guideline"/>
+            <p>In the early phases of our project, we encountered several challenges while working to bring it together. We quickly decided to focus on human biomaterials, specifically cultivating primary human nasal epithelial cells from both cystic fibrosis (CF) patients and wild-type controls. To ensure compliance, we carefully evaluated the safety regulations of our institution and government. Our contribution includes three key elements: </p>
+            <ol>
+                <li>    A guideline outlining the proper handling of biomaterials according to BSL2 standards, along with additional safety measures to ensure secure experimental design. </li>
+                <li>    A clinical trial-style questionnaire designed to assess the medical history of participants donating nasal epithelial cells. </li>
+                <li>    A hygiene protocol aimed at improving safety and cleanliness standards in various institutions and sanitary facilities. </li>
+            </ol>
             <PDF link="https://static.igem.wiki/teams/5247/pdfs/primary-culture-guideline.pdf" name="primary-culture-guideline.pdf"/>
             <PatientContribution/>
+            <p>By contributing these frameworks, we enable future iGEM teams to overcome potential limitations that may arise during project development. These resources provide clear guidelines and tools to ensure safety, regulatory compliance, and efficient workflow, allowing teams to focus on advancing their research without facing similar challenges. </p>
         </Subesction>
     </>
 

src/contents/Home.tsx

@@ -29,7 +29,7 @@ export function Home() {
                 <p>
                   &#8594; <a href="description?scrollTo=Abstract">What is <PreCyse/>? </a> <br/> <br/> 
                   &#8594; <a href="engineering?tab=tab-our-cycle&scrollTo=ourcycle">What is our strategy?</a> <br/> <br/>
-                  &#8594; <a href="experiments?tab=heading">How did we do this?</a> <br/> <br/>
+                  &#8594; <a href="materials-methods?scrollTo=introduction">How did we do this?</a> <br/> <br/>
                   &#8594; <a href="results?scrollTo=experimental-design">What did we archieve?</a> <br/> <br/>
                   &#8594; <a href="parts?scrollTo=Parts Collection2">What parts are we contributing?</a> <br/> <br/>
                   &#8594; <a href="judging?scrollTo=OverviewH">What are our special awards?</a>

src/contents/Human Practices/Further Engagement/Entrepreneurship.tsx

 import {  ButtonOneWithScroll } from "../../../components/Buttons";
 import { H4, H5 } from "../../../components/Headings";
-import { LoremShort } from "../../../components/Loremipsum";
 
 
 export function HPEntrepreneur(){
@@ -26,7 +25,14 @@ export function HPEntrepreneur(){
             <p>That is why in this section we focus on the aspects of entrepreneurship that are crucial for the potential successful realisation of our project to develop new therapies for cystic fibrosis. A pivotal moment was our interview with Nicole Friedlein, which gave us valuable insights into the challenges and opportunities in the field of biomedical innovation. The discussions in the interview encouraged us to look more closely at the regulatory requirements, which is why one team member completed a GxP course and subsequently trained the team in this area. In addition, we conducted further interviews in the area of entrepreneurship to gain a better understanding of the practical aspects of business development. These experiences not only enriched the scientific depth of our project, but also sharpened our perspective on the practical implementation and market launch of new therapies. 
             </p>
             <H4 id="ent-heading" text="Our Entrepreneurship"/>
-            <LoremShort/>
+            <p>In conclusion, the entrepreneurial journey of developing RNA-based gene therapy for cystic fibrosis, as outlined in our experiences and interviews with industry founders, demonstrates that entrepreneurship is not only an interesting possibility but a necessary avenue to transform scientific innovation into real-world solutions. Our approach has been shaped by the challenges and opportunities in the biotech field, from understanding regulatory frameworks like GxP to navigating complex market dynamics and funding challenges. </p>
+            <p>Through key interviews, such as the one with Nicole Friedlein, we have gained insights into the pivotal role of regulatory standards in scaling our project. The completion of GxP training by one team member reflects our commitment to ensuring compliance with Good Laboratory Practice (GLP) and Good Manufacturing Practice (GMP), both of which are essential for advancing from proof-of-concept to clinical trials. This foundation is crucial for building investor confidence and meeting regulatory requirements.</p> 
+
+            <p>Additionally, market evaluations reveal a significant opportunity for our therapy, particularly targeting the unmet needs of cystic fibrosis patients who do not respond to current treatments like CFTR modulators. The growing gene therapy market presents a strong case for our innovation, although we are aware of the competitive landscape dominated by companies like Vertex Pharmaceuticals. Our unique value lies in providing a more permanent solution for patients not served by existing treatments. </p>
+
+            <p>Interviews with founders from companies such as PlasmidFactory and RNhale have provided valuable lessons on transitioning from research to commercialization. The importance of building networks, securing diverse funding sources, and maintaining flexibility to adapt to market feedback are key takeaways that will guide our next steps. Establishing strategic partnerships and seeking early engagement with regulatory bodies will be essential as we prepare for clinical trials and eventual market entry.</p> 
+
+            <p>To align our long-term vision of revolutionizing cystic fibrosis treatment with immediate milestones, we will continue optimizing our lipid nanoparticle delivery system, pursuing regulatory compliance, and engaging with the cystic fibrosis community to refine our product. Our focus on both the scientific and business aspects ensures that we are building a strong foundation for success in bringing this innovative therapy to market, improving the lives of patients with cystic fibrosis. </p>
         </div>
 
         <div id="ent-interview" className="ent-interview" style={{display: "none"}}>

src/contents/experiments.tsx

-
-import { H2 } from "../components/Headings";
-import { useTabNavigation } from "../utils/TabNavigation";
-
-export function Experiments() {
-  useTabNavigation();
-  return (
-    <>
-      <H2 id="heading" text="Heading" ></H2>
-      <div className="row mt-4">
-        <div className="col-lg-8">
-          
-        </div>
-
-      </div>
-    </>
-  );
-}

src/contents/index.tsx

@@ -9,7 +9,6 @@ export * from "./Contribution/contribution.tsx";
 export * from "./description.tsx";
 export * from "../sidebars/descS.tsx"
 export * from "./engineering.tsx";
-export * from "./experiments.tsx";
 export * from "./notebook.tsx";
 export * from "./results.tsx";
 // Safety
@@ -26,7 +25,6 @@ export * from "../headers/attribution-h.tsx"
 export * from "../headers/cont-h.tsx"
 export * from "../headers/desc-h.tsx"
 export * from "../headers/home-h.tsx"
-export * from "../headers/exp-h.tsx"
 export * from "../headers/hp-h.tsx"
 export * from "../headers/imp-h.tsx"
 export * from "../headers/note-h.tsx"

src/contents/methods.tsx

@@ -83,14 +83,14 @@ export function Methods() {
                   </figcaption> 
                 </figure> 
               </div> 
-              <div className='col'>
+            <div className='col'>
             <p>To evaluate the cytotoxicity of our LNPs, we conducted an MTT assay, which measures the metabolic activity of cells. This assay is based on the ability of living cells to reduce MTT, a yellow tetrazolium salt, into purple formazan crystals through NAD(P)H-dependent enzymes. Cells were treated with various concentrations of LNPs, and after dissolving the formazan crystals with DMSO, we measured absorbance. Higher absorbance values indicate greater cell viability. Our results showed no significant reduction in cell viability across all LNP concentrations, demonstrating that the LNPs did not induce cytotoxic effects. This finding is crucial for ensuring that the LNPs are safe for biological use, supporting their potential in clinical applications such as drug delivery and gene therapy. Overall, the MTT assay provided strong evidence of the biocompatibility of our LNPs. </p>
             </div>
             </div> 
           <H4 text="Proliferation Assay to Monitor Long-Term Safety"></H4>
             <p>In addition to assessing immediate cytotoxicity, we also evaluated the long-term safety of the LNPs by conducting a proliferation assay. This assay tracked cell division and growth over time to determine whether the LNPs impacted cellular function. Our results showed that LNP-treated cells had similar growth rates to untreated controls, indicating that the LNPs do not interfere with normal cell processes. This further confirms their biocompatibility and suitability for use in biological systems.</p>
           </Subesction>
-          <Subesction title="Fluorescence-Activated Cell Sorting (FACS)" id="FACS">
+          <Subesction title="Flow cytometry" id="FACS">
             <p>To assess the transfection efficiency of our LNPs, we used fluorescence-activated cell sorting (FACS). This method involved tagging the LNPs with fluorescent markers and measuring their ability to deliver genetic material into target cells. FACS provided quantitative insights into how effectively the LNPs transfected cells, helping us optimize their design for gene therapy applications. </p>
           </Subesction>
 

src/contents/parts.tsx

@@ -29,12 +29,6 @@ export function Parts() {
           <Subesction title="Cloning" id="Experiments1">
             <LoremMedium/> 
           </Subesction>
-          <Subesction title="Nikase-Assay" id="Experiments2">
-            <LoremMedium/> 
-          </Subesction>
-          <Subesction title="Activity Experiments" id="Experiments3">
-            <LoremMedium/> 
-          </Subesction>
         </Section>
         <Section title="Parts Collection" id="Parts Collection">
           <Subesction title="Plasmids" id="Parts Collection1">

src/contents/results.tsx

@@ -7,6 +7,8 @@ import { H5 } from "../components/Headings";
 import { useNavigation } from "../utils";
 import { DownloadLink } from "../components/Buttons";
 import { ThreeVertical, TwoHorizontal, TwoVertical } from "../components/Figures";
+import { ResTable } from "../components/Table";
+import { headercols, resultdata } from "../data/results-table";
 
 
 export function Results() {
@@ -21,7 +23,6 @@ export function Results() {
       </Section>
       <Section title="Experimental Design" id="ExpDes">
       <Subesction title="Proof of Concept" id="Results1">
-      <h4>acc. to David Liu (Anzalone et al. 2019)</h4>
           <H4 text="Proof-of-concept"/>
           <H5 text="Workflow"/>
           <p>The prepared pDAS12124-preedited plasmid serves as a positive control to validate the success of the experiment. A technical control with the pZMB938 plasmid confirms successful transfection of the cells. In the main part of the experiment, pDAS12489-2in1 and pCMV-PE2 are co-transfected. Successful transfection is visualised by GFP signals.</p> 
@@ -98,9 +99,9 @@ export function Results() {
           <H5 text="Workflow"/>
           <p>With this experiment we wanted to compare the efficiency of pegRNAs with and without silent edits.</p> 
           <H5 text="Conclusion"/>
-          <p>The FACS analysis shows that pegRNA without silent edits (pegRNA1) had a 2.05 times higher transfection efficiency than pegRNA with silent edits (pegRNA2).</p>         
+          <p>The Flow Cytometry analysis shows that pegRNA without silent edits (pegRNA1) had a 2.05 times higher transfection efficiency than pegRNA with silent edits (pegRNA2).</p>         
           <TwoHorizontal 
-            description="FACS analysis of pegRNAs with and without silent edits."
+            description="Flow Cytometry analysis of pegRNAs with and without silent edits."
             num={8}
             pic1="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/se-nose.png"
             pic2="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/bild8.png"
@@ -110,11 +111,11 @@ export function Results() {
           <p>Cotransfection of pPEAR_CFTR and PE2 and also 1 of the 14 pegRNAs to compare the transfection efficiency of all of our designed pegRNAs.</p> 
           <H5 text="Conclusion"/>
           <p>The pegRNAs lead to differing amounts of cells showing fluorescence, which, assuming comparable transfection efficiencies, indicates varying prime editing efficiency. The pegRNA7 showed the highest transfection efficiency (see Figure 9).</p>
-          <p>HIER BITTE EINE TABELLE (15 ZEILEN & 5 SPALTEN)</p>
+          <ResTable cols={headercols} data={resultdata}/>
           <div className="figure-wrapper">
               <figure>
                     <img src="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/bild9.png" style={{height: "10%", width: "auto"}}/>
-                    <figcaption> <b>Figure 9.</b>FACS results of all screened pegRNAs</figcaption>
+                    <figcaption> <b>Figure 9.</b>Flow Cytometry results of all screened pegRNAs</figcaption>
               </figure>
           </div>
           <H4 text="Application lung epithelial cell lines"/>
@@ -132,7 +133,7 @@ export function Results() {
           <H5 text="Workflow"/>
           <p>pCMV-PE2 was co transfected with pDAS12489 and pCMV-PE_CO-Mini was co transfected with pDAS12489 in HEK293 cell line.</p> 
           <H5 text="Conclusion"/>
-          <p>The FACS results show that transfection with pCMV-PE2 as the prime editing complex had editing efficiency of 52.90% when normalized on pDAS12124-preedited. When pCMV-PE_CO-Mini was used as a prime editing complex it had a transfection efficiency of 2.54% (see Figure 11, 12).</p>
+          <p>The Flow Cytometry results show that transfection with pCMV-PE2 as the prime editing complex had editing efficiency of 52.90% when normalized on pDAS12124-preedited. When pCMV-PE_CO-Mini was used as a prime editing complex it had a transfection efficiency of 2.54% (see Figure 11, 12).</p>
           <TwoVertical
            description="Microscopy of HEK 72h post transfection with lipofectamine 3000. Co-transfection of pDAS12489 with pCMV-PE2 or pDAS12489 with LV-PE_CO-Mini. Both show fluorescence signals."
            num={11}
@@ -142,13 +143,13 @@ export function Results() {
            <div className="figure-wrapper">
               <figure>
                     <img src="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/pe2-pe-co.png" style={{height: "10%", width: "auto"}}/>
-                    <figcaption> <b>Figure 12</b>FACS analysis to compare prime editing complexes PE2 and PE_CO-Mini</figcaption>
+                    <figcaption> <b>Figure 12</b>Flow Cytometry analysis to compare prime editing complexes PE2 and PE_CO-Mini</figcaption>
               </figure>
           </div>
           <H5 text="Workflow"/>
           <p>We compared the 3 different Prime Editing complexes (pCMV-PE2, pCMV-PE2_CO-Mini & pCMV-PE6c) to check which one has the best transfection efficiency.</p> 
           <H5 text="Conclusion"/>
-          <p>The FACS measurement shows the fluorescence rate cells co-transfected with pDAS12489 and pCMV-PE6c as a prime editing complex. The editing efficiency off PE6c was by far the highest (81.88%) (see Figure 13, 14). The efficiency was 1.55 higher than the efficiency when pCMV-PE2 was used as prime editing complex (see Figure 13).</p>
+          <p>The Flow Cytometry measurement shows the fluorescence rate cells co-transfected with pDAS12489 and pCMV-PE6c as a prime editing complex. The editing efficiency off PE6c was by far the highest (81.88%) (see Figure 13, 14). The efficiency was 1.55 higher than the efficiency when pCMV-PE2 was used as prime editing complex (see Figure 13).</p>
           <div className="figure-wrapper">
               <figure>
                     <img src="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/bild13.png" style={{height: "10%", width: "auto"}}/>
@@ -156,7 +157,7 @@ export function Results() {
               </figure>
           </div>
           <TwoHorizontal
-          description="FACS results for evaluation of PE6c performance."
+          description="Flow Cytometry results for evaluation of PE6c performance."
           num={14}
           pic1="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/pe2-pe-co-pe6c.png"
           pic2="https://static.igem.wiki/teams/5247/photos/facs-results-mechanism/bild12.png"
@@ -270,9 +271,9 @@ export function Results() {
                 Description here
               </figcaption>
             </figure>
-        <H5 text="FACS"/>
+        <H5 text="Flow cytometry"/>
           <div className="row align-items-center">
-          <p>We performed FACS analysis 72 h post-transfection to evaluate the transfection efficiency of the SORT LNP in HEK293. The relative percentage of fluorescent cells was determined by measuring the percentage of FITC-A+ cells, followed by normalization to the negative control and fold change calculation.</p>
+          <p>We performed flow cytometries analysis 72 h post-transfection to evaluate the transfection efficiency of the SORT LNP in HEK293. The relative percentage of fluorescent cells was determined by measuring the percentage of FITC-A+ cells, followed by normalization to the negative control and fold change calculation.</p>
             <div className="col">
               <figure>
               <img src="https://static.igem.wiki/teams/5247/delivery/results/sortlnp-facs.png" alt="SORTFACS" style={{maxHeight: "200pt"}}/> 
@@ -416,3 +417,6 @@ export function Results() {
   );
 }
 
+
+
+

src/data/hptimelinedata.tsx

@@ -121,6 +121,7 @@ const pics: { [key: string]: string } = {
   labsupply: "https://static.igem.wiki/teams/5247/photos/hp/labsupply-info.webp",
   hamburg: "https://static.igem.wiki/teams/5247/photos/hp/gruppenbild-hamburg.webp",
   sriram: "https://static.igem.wiki/teams/5247/photos/sriram.svg",
+  logo: "https://static.igem.wiki/teams/5247/logos-team/precyse-no-slogan.png"
   
 };
 
@@ -342,17 +343,40 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Looking for expertise",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
+    job: "Team iGEM",
+    affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
     heading: "Identifying key experts in cystic fibrosis and prime editing",
     interviewtabid: "experts",
     cardtext: "",
-    quote: "",
-    aimofcontact: "",
-    insights: "",
-    implementation: "",
+    quote: "Focusing on gene therapy for cystic fibrosis has been a meaningful journey for our team. Collaborating with experts has enriched our understanding and helped us refine our approach, especially in exploring prime editing. We're eager to turn our plans into reality and make a real impact",
+    quoteNachname:"Kanthak, Teammember",
+    quoteVorname: "Kai",
     type: "meta",
-    summary: "",
+    summary: [<p>After our team came together and thoroughly explored various project ideas, we decided to focus on gene therapy for cystic fibrosis, largely due to a personal connection with a close friend affected by the condition. Up until that point, we had not yet developed a concrete concept, so we sought to engage with experts in order to broaden our understanding of the latest advancements in gene therapy.
+      In addition to grasping the importance of a functional gene therapy, we delved into different strategies regarding the underlying mechanisms and the best delivery methods for the therapy. While the general topic of our project was clear, we now faced the challenge of working out the details. At this stage, we decided to consult further experts in the field of cystic fibrosis to deepen our knowledge and refine our approach.
+      Through connections with the University Hospital Münster and our local hospital, we aimed to gain a comprehensive overview of the clinical applications of gene therapy and the current research in cystic fibrosis. These consultations with specialists allowed us to acquire valuable insights into different therapeutic options and laid the groundwork for our own exploration of potential strategies, particularly in the area of prime editing as a promising treatment avenue.</p>,
+      <ul>
+      <li>
+          <strong>Team Formation & Research:</strong> Chose gene therapy for cystic fibrosis and explored mechanisms and delivery strategies.
+      </li>
+      <li>
+          <strong>Expert Engagement:</strong> Consulted with specialists to refine approach, focusing on prime editing.
+      </li>
+      <li>
+          <strong>Medical Collaboration:</strong> Gained clinical insights through partnerships with hospitals.
+      </li>
+      <li>
+          <strong>Project Development:</strong> Developed detailed plans for gene therapy, incorporating expert feedback.
+      </li>
+      <li>
+          <strong>Testing & Future Application:</strong> Plan to test strategies and prepare for potential clinical trials.
+      </li>
+  </ul>
+   
+    ],
+    
     months: "April"
   },
   {
@@ -464,21 +488,33 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   },
   {
     vorname: "Exploring new ideas",
-    nachnname: "x",
-    pictureurl: pics['placeholder'],
+    nachnname: "",
+    pictureurl: pics['logo'],
     tag: "Milestone",
-    affiliation: "",
-    heading: "Further brainstorming on approaches",
-    interviewtabid: "brainstorming",
+    job: "Team iGEM",
+    affiliation: "Bielfeld CeBiTec 2024",
+    heading: "Further brainstorming on approaches and specifing the project",
+    interviewtabid: "exploring",
     cardtext: "",
-    quote: "x",
-    quoteNachname:"x",
-    quoteVorname: "d",
-    aimofcontact: "d",
-    insights: "d",
-    implementation: "d",
+    quote: "One of the most valuable aspects of our project is the feedback we've received. It truly motivates us to make a difference in the community.",
+    quoteNachname:"Sanfilipo, Teammember",
+    quoteVorname: "Liliana",
     type: "meta",
-    summary: "d",
+    summary:[<p>After receiving valuable feedback from both clinical and academic experts, we decided to focus on optimizing Prime Editing strategies for cystic fibrosis treatment. Both experts not only encouraged us in our approach but also provided insightful feedback, which we will integrate into our future project design. Through these discussions, we learned that current treatment strategies are urgently needed in real life but are limited in precision and efficiency.
+      Additionally, we gained key insights into lung-specific delivery methods, which inspired us to pursue lung-specific correction of the CFTR gene, a critical aspect of cystic fibrosis therapy.
+      At this stage, we are eager to expand our perspectives by seeking input from industry and business professionals, while also striving to increase our local impact. To evaluate this impact, we plan to develop a survey aimed at understanding the interest in gene therapy and the community’s knowledge of cystic fibrosis within our local area. This will help us gauge awareness and ensure our project addresses both scientific and societal needs effectively.</p>>
+      <ul>
+          <li>
+              <strong>Expert Feedback Integration:</strong> Refined the project focus on optimizing Prime Editing strategies and lung-specific gene delivery based on clinical and academic insights.
+          </li>
+          <li>
+              <strong>Focus on Lung-Specific Correction:</strong> Shifted toward lung-specific CFTR gene correction for cystic fibrosis treatment.
+          </li>
+          <li>
+              <strong>Community Engagement Plan:</strong> Initiated plans for a local survey to assess awareness of cystic fibrosis and interest in gene therapy, aiming to increase local impact.
+          </li>
+      </ul>  
+    ],
     months: "may"
   },
   {
@@ -544,17 +580,39 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Documenting progress",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     tag: "Milestone",
+    job: "Team iGEM",
+    affiliation: "Bielfeld CeBiTec 2024",
     heading: "Tracking progress in expert search and idea development",
     interviewtabid: "progress",
     cardtext: "",
-    quote: "",
-    aimofcontact: "",
-    insights: "",
-    implementation: "",
+    quote: "I believe our focus on a human-centric approach is crucial. It ensures that our research not only advances science but also prioritizes the needs and safety of the patients we aim to help.",
+    quoteNachname:"Lange, Teammember",
+    quoteVorname: "Kaya",
     type: "meta",
-    summary: "",
+    summary: [<p>
+      Early in our research, we committed to a human-centric approach, recognizing the importance of working according to Good Laboratory Practice (GLP) standards. At this point, we also identified key Special Prizes to aim for, including the Biosafety and Security Award, Best New Basic Part, and Best Integrated Human Practices. To further advance our project, we partnered with Stemcell Technologies, whose technical support provided valuable insights. This collaboration allowed us to explore the cultivation of primary human nasal epithelial cells, which are crucial for testing our synthetic biology components and Prime Editing technologies. In line with this, we expanded our biosafety standards to ensure compliance with higher safety levels and enhanced our understanding of preclinical trial-like experiments. Moreover, we are committed to raising awareness within our local community while also seeking to broaden our impact internationally. This dual focus helps us ensure both the safety and societal relevance of our project as we move forward.
+        </p>,
+  
+        <ul>
+            <li>
+                <strong>Commitment to Human-Centric Approach:</strong> Early in the project, the decision to follow a human-centric approach ensured that societal impact, ethical considerations, and the needs of patients would be central to all scientific developments.
+            </li>
+            <li>
+                <strong>Selection of Special Prizes (Biosafety and Security, Best Integrated Human Practices):</strong> Prioritizing biosafety, security, and human practices from the start highlighted the project’s focus on safety, ethical responsibility, and community engagement, aligning with broader human-centric goals.
+            </li>
+            <li>
+                <strong>Collaboration with Stemcell Technologies:</strong> Partnering with industry leaders provided technical expertise that allowed the team to deepen their understanding of human cell cultivation and gene editing, ensuring that the project’s technological developments were informed by real-world applications.
+            </li>
+            <li>
+                <strong>Expansion of Biosafety Standards:</strong> Extending biosafety protocols to mimic preclinical trial conditions reinforced the commitment to safe, ethical research practices and laid the groundwork for clinical relevance, demonstrating responsibility toward future patients.
+            </li>
+            <li>
+                <strong>Local and International Community Engagement:</strong> Efforts to raise awareness at both local and global levels ensured that the project was not only scientifically sound but also socially responsible, with a focus on educating and involving the public in the conversation around cystic fibrosis and gene therapy.
+            </li>
+        </ul>
+        ],
     months: "may"
   },
   {
@@ -683,18 +741,32 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Integrate Insights",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
-    heading: "Getting Acquainted with Cystic Fibrosis",
+    heading: "From Insights to Impact: Enhancing Awareness and Prime Editing for Cystic Fibrosis",
     interviewtabid: "inisghts",
     cardtext: "",
     quoteNachname: "Köhler, Teammember",
     quoteVorname: "Vera",
-    quote: "Firstly, we discussed various project ideas, including the use of magnetic microswimmers for targeted medical applications, gene editing approaches for cystic fibrosis, treatments for muscular dystrophy and combating cyanobacteria with algae.",
+    quote: "I’m excited about our partnership with Mukoviszidose e.V. Deutschland to raise awareness in our community. Educating people about cystic fibrosis and gene therapy is essential, and I believe our scientific advancements will have a broader impact beyond just this condition.",
     type: "meta",
-    summary: "",
+    summary: [<p>
+            During the early stages of our project, we discovered through our survey that while many participants were open to trying gene therapies, they lacked adequate knowledge about them. Additionally, most respondents were unfamiliar with cystic fibrosis, highlighting the need for greater awareness. Driven by a desire to educate the people of Bielefeld, we collaborated with Mukoviszidose e.V. Deutschland to support the Muko Move campaign, a successful initiative aimed at raising awareness about cystic fibrosis. On the scientific front, we elevated our project to a new level. With valuable feedback from Mattijs Bulcaen at the University of Leuven, we incorporated a novel RNA structural element into our Prime Editing complex, significantly improving its efficiency. After successfully optimizing the pegRNA, we moved forward with enhancing the Prime Editing protein complex. Our goal is to make Prime Editing not only safer but also easier to apply, so that our research can benefit more than just cystic fibrosis patients, ultimately broadening the impact of our work.
+        </p>,
+        
+        <ul>
+            <li>
+                <strong>Survey Insights:</strong> Many participants were motivated to try gene therapies but lacked knowledge about them and cystic fibrosis, highlighting the need for better public education.
+            </li>
+            <li>
+                <strong>Awareness Campaign:</strong> Partnered with Mukoviszidose e.V. Deutschland to support the Muko Move campaign, raising awareness about cystic fibrosis in the local community.
+            </li>
+            <li>
+                <strong>Scientific Advancements:</strong> Improved the efficiency of Prime Editing by incorporating a novel RNA structural element, with further efforts to optimize the Prime Editing protein complex for broader applicability beyond cystic fibrosis.
+            </li>
+        </ul>],
     months: "june"
   },
   {
@@ -1050,7 +1122,7 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Close the Loop",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
@@ -1369,7 +1441,7 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Present evidence",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
@@ -1568,7 +1640,7 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Connect and Share",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
@@ -1976,37 +2048,35 @@ export const timelinedata: Array<TimelineDatenpunkt>  = [
   {
     vorname: "Grand Jambooree in Paris",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
-    heading: "Brainstorming and selection of ideas and concepts",
+    heading: "Preparations for the Grand Jambooree in Paris",
     interviewtabid: "jamboree",
     cardtext: "",
-    quote: "",
-    aimofcontact: "",
-    insights: "",
-    implementation: "",
+    quote: "I’m really nervous about the judging session. It feels like all our hard work is leading up to this moment, and I just hope we make a strong impression!",
+    quoteNachname: "Guckes, Teammember",
+    quoteVorname: "Isabell",
     type: "meta",
-    summary: "",
+    summary: "As the team gears up for the Grand Jambooree in Paris, our focus has been on finalizing our presentation materials, including a dynamic presentation video that showcases our project and research findings. We are preparing for various formats of engagement, such as presentations and talks, where we’ll share our insights with fellow participants. Additionally, our poster session will provide an opportunity for interactive discussions, and we are bracing for the judging sessions that will critically evaluate our work.",
     months: "october"
   },
   {
     vorname: "Carry It Forward",
     nachnname: "",
-    pictureurl: pics['placeholder'],
+    pictureurl: pics['logo'],
     job: "Team iGEM",
     affiliation: "Bielfeld CeBiTec 2024",
     tag: "Milestone",
-    heading: "Brainstorming and selection of ideas and concepts",
+    heading: "The future of our project PreCyse",
     interviewtabid: "forward",
     cardtext: "",
-    quote: "",
-    aimofcontact: "",
-    insights: "",
-    implementation: "",
+    quote: "I hope to start my Master's thesis with this approach to build on the team's hard work and make a difference.",
+    quoteNachname: "Lange, Teammember",
+    quoteVorname: "Kaya",
     type: "meta",
-    summary: "",
+    summary: [<p>As we move forward with our project, our intention is to continue our research and development at our university. We believe that by building on our current findings, we can make significant contributions to the field. Additionally, we are considering reaching out to Mattjis Bulcaen at KU Leuven for potential collaboration in the future, as their expertise could further enhance our work.</p>],
     months: "october"
   },
  

src/data/results-table.tsx

+export interface Res{
+    nr: string, 
+    silent: string, 
+    att: string, 
+    pbs: string, 
+    q1: string,
+}
+
+export const headercols = [
+    "Nr.", "Silent Edits", "ATT-Lengths", "PBS-Length", "trevopreQ1"
+]
+
+export const resultdata: Res[] = [
+
+    {
+        nr: "", 
+        silent: "", 
+        att: "", 
+        pbs: "", 
+        q1: "",
+    },
+    {
+        nr: "", 
+        silent: "", 
+        att: "", 
+        pbs: "", 
+        q1: "",
+    },
+    {
+        nr: "", 
+        silent: "", 
+        att: "", 
+        pbs: "", 
+        q1: "",
+    }
+
+]
\ No newline at end of file

src/headers/exp-h.tsx

-export function EXPH() {
-
-  return (
-    <HeaderBox title="Experiments" id="exhead">
-      
-    </HeaderBox>
-  );
-}
-
-import HeaderBox from "../components/HeaderBox";
\ No newline at end of file

src/pages.ts

@@ -2,7 +2,6 @@
   Contribution,
   Description,
   Engineering,
-  Experiments,
   Home,
   Attributions,
   HumanPractices,
@@ -22,7 +21,7 @@
   SafetySidebar
 } from "./contents"; 
 import { DescSidebar, NoSidebar, EngSide } from "./contents";
-import {  IBIE,  JUDGEH, PRODESC,  SUPH, PARTH, ENGH,  HOMEH, HPH, SPONH, RESH, ATTH, CONTH, DESCH, EXPH, IMPH, NOTEH, SAFEH, TEAMH } from "./contents";
+import {  IBIE,  JUDGEH, PRODESC,  SUPH, PARTH, ENGH,  HOMEH, HPH, SPONH, RESH, ATTH, CONTH, DESCH, IMPH, NOTEH, SAFEH, TEAMH } from "./contents";
 import { Methods } from "./contents/methods";
 import { METHH } from "./headers/meth-h";
 import { ConSidebar } from "./sidebars/conS";
@@ -100,14 +99,6 @@ const Pages: (Page | Folder)[] = [
       header: HOMEH,
       navlist: NoSidebar,
     },
-    {
-      name: "Experiments",
-      title: "Experiments",
-      path: "/experiments",
-      component: Experiments,
-      header: EXPH,
-      navlist: NoSidebar,
-    },
     {
       name: "Human Practices",
       title: "Human Practices",
@@ -263,9 +254,9 @@ export const NavPages: (Page | PageRef | Folder)[] = [
             path: "/engineering"
           },
           {
-            name: "Experiments",
-            title: "Experiments",
-            path: "/experiments?tab=heading"
+            name: "Materials & Methods",
+            title: "Materials & Methods",
+            path: "/materials-methods?scrollTo=introduction"
           },
           {
             name: "Results",
@@ -369,14 +360,6 @@ export const NavPages: (Page | PageRef | Folder)[] = [
     {
       name: "Lab", 
       folder: [
-        {
-          name: "Experiments",
-          title: "Experiments",
-          path: "/experiments",
-          component: Experiments,
-          header: EXPH,
-          navlist: NoSidebar,
-        },
         {
           name: "Materials & Methods",
           title: "Materials & Methods",
@@ -490,27 +473,17 @@ export const NavPages: (Page | PageRef | Folder)[] = [
           {
             name: "BFH European MeetUp",
             title: "MeetUp",
-            path: "contribution/?scrollTo=BFH European MeetUp"
+            path: "contribution/?scrollTo=bfh-european-meetup"
           },
           {
-            name: "Safety Guideline",
-            title: "Safety Guideline",
-            path: "contribution/?scrollTo=primary-culture-safety-guideline"
+            name: "Our Contributions",
+            title: "Our Contributions",
+            path: "contribution/?scrollTo=our-contributions"
           },
           {
             name: "Collaborations",
             title: "Collaborations",
-            path: "contribution/?scrollTo=collaborations"
-          },
-          {
-            name: "Patient Matters",
-            title: "Patient Matters",
-            path: "contribution/?scrollTo=patient-matters"
-          },
-          {
-            name: "Wiki",
-            title: "Wiki",
-            path: "contribution/?scrollTo=wiki"
+            path: "contribution/?scrollTo=our-collaborations"
           },
           ]
     },