PartCon.tsx

import { H4 } from "../../components/Headings";
import { PDF } from "../../components/Pdfs";
import { Subesction } from "../../components/sections";

export function PartContribution(){

    return(

        <Subesction title="Parts" id="Our Contributions2">
              <H4 text="Our Protocol Collection"/>
              <PDF link="https://static.igem.wiki/teams/5247/pdfs/protocol-collection-igem-2024.pdf" name="protocol-collection-igem-2024.pdf"/>
              <p>ShapeOur contribution includes an extensive collection of optimized protocols designed to provide future iGEM teams with easy-to-use starting materials. We've refined these protocols and compiled them into comprehensive summaries, incorporating our experiences, tips, and tricks to make synthetic biology more accessible and enjoyable, especially for newer iGEM teams. Additionally, we have integrated safety and security standards into the protocols, making it easier to introduce the handling of human biomaterials in the iGEM competition while ensuring compliance with necessary regulations. This collection is intended to streamline the workflow and empower teams to approach their projects with greater confidence. </p>
              <H4 text="Our Reporter System PreCL"/>
              <p>To effectively test different Prime Editing systems and pegRNAs targeting the CF-specific genomic mutation (delF508), we developed a highly sensitive reporter system called PreCL (Prime Editing Conceptualizable Light). This system is designed to detect fluorescence signals across a variety of devices, offering flexibility in measurement and ensuring reliable, high-quality results. </p>
              <p>PreCL is characterized by its high sensitivity, with minimal background noise, allowing for precise and accurate detection. Additionally, it closely mimics the CF genomic context, making it highly relevant for CF-specific research. The system features an easy-to-read output, simplifying the interpretation of experimental data, and is designed for constitutive performance, ensuring consistency across tests. </p>
              <p>One of the standout features of PreCL is its modular design, which allows it to be adapted to different genomic contexts, extending its utility beyond CF research. While it is optimized for Prime Editing, it also has potential applications for broader genetic approaches such as CRISPR/Cas and base editing. With these advantages, PreCL offers a powerful and versatile tool that facilitates testing and enhances the precision and efficiency of genetic research. </p>
              <img src="https://static.igem.wiki/teams/5247/engineering-cycle/precl.svg"/>
              <H4 text="Our pegRNA Architecture"/>
              <p>In our research, we optimized the structure of pegRNAs to develop a stable and efficient variant with enhanced sensitivity. By incorporating the novel RNA structural motif TevoPreQ1, we improved the stability and complex formation of the pegRNA, ensuring higher Prime Editing throughput. Additionally, we introduced silent edits to promote mismatch repair, further boosting Prime Editing efficiency. By fine-tuning the length of the Reverse Transcriptase Template and Primer Binding Sequence, we ensured optimal pegRNA performance, maximizing editing efficiency. </p>
            <p><small>5‘TCTGTATCTATATTCATCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGATATGTTCAGGTAAGTGTGTCATACGATGAATATAGATACAGCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTT3‘ </small></p>
                <H4 text="Our Prime Editing Technology PrimeGuide "/>
                <div className="row">
                    <div className="col">
                        <img src="https://static.igem.wiki/teams/5247/engineering-cycle/pecomplex.svg"/>
                    </div>
                    <div className="col">
                        <p>We developed a groundbreaking Prime Editing system designed to overcome current limitations in genome editing. As part of this innovation, we introduced a novel eukaryotic RNA-binding DNA-nickase protein, created through enzyme engineering. This protein serves as a much smaller alternative to the traditional Cas9, making it easier to use in Prime Editing and other genetic applications. </p>
                    </div>
                </div>
                <p>Additionally, we implemented significant improvements, such as a more efficient Reverse Transcriptase and optimized RNA-binding proteins, which together enhance the overall efficiency of the Prime Editing complex while minimizing off-target effects. </p>

                <div className="row">
                    <div className="col">
                        <img src="https://static.igem.wiki/teams/5247/engineering-cycle/primeguide-logo.svg"/>
                    </div>
                    <div className="col">
                        <p>By contributing this advancement, we enable safer and more precise Prime Editing for correcting genetic mutations. Our composite part is versatile and can be applied to various contexts, offering immense value to the synthetic biology community. This contribution not only enhances Prime Editing technologies but also provides future researchers with more robust tools for their genetic engineering endeavors. </p>
                    </div>
                </div>
                <H4 text="Our Lipid Nanoparticle AirBuddy "/>
                <img src="https://static.igem.wiki/teams/5247/engineering-cycle/airbuddy-overview.svg"/>
                <p>Our innovative delivery system enables the lung-specific transport of RNA and DNA molecules into eukaryotic cells, offering a significant advancement for gene therapies targeting lung diseases. This formulation overcomes the limitations of current delivery strategies by providing an advanced dry powder inhalation technology designed for controlled monthly use and cost-effective long-term storage, making it highly practical for sustained treatments. </p>
                <p>The delivery system stands out for its low cytotoxicity compared to traditional methods like DEMPEG, ensuring a safer application. Its positively charged formulation is optimized for the efficient binding and transport of negatively charged lung cells, enhancing cargo delivery. The system's ideal size distribution further promotes efficient cellular uptake, resulting in significantly higher transfection rates compared to standard reagents like Lipofectamine. </p>
                <p>Moreover, its lung-specific design makes it particularly suitable for treating various lung-specific diseases, while its sphere-like structures ensure excellent stability for use in dry powder inhalation therapies. This breakthrough in delivery technology provides a safer, more efficient, and cost-effective solution for delivering genetic material to target cells, with the potential to revolutionize lung disease treatments. </p>
                
          </Subesction>
    )
}