<h3>2. The characteraztion of the Yeast two hybrid Library</h3>
<p> The 150-bp insert fragments were amplified using primers CCAGATTACGCTCATATGACAAGTTTGTAC and TCATCTGCAGCTCGAGACCACTTTGTACAA. The constructed libraries were sequenced using the Illumina Novaseq 6000 platform to generate raw data, following the manufacturer’s instructions by the company of ANNOROAD Biotech. Co., Ltd. (China). After quality control, about 34.5 GB of clean data were generated. According to the design principles (TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC-(NNK)20-TAAGACCCAACTTTCTTGTACAAAGTTGTGCGGCCGCC), 60bp random sequences were extracted from the clean data and translated into amino acid sequences using standard genetic codons. The translation was stopped from the first stop codon, and peptides less than five aa in length after translation were removed. Finally, we obtained 68,190,232 peptides in total and 3,359,176 peptides after removing redundancy.
<p> The 150-bp insert fragments were amplified using primers CCAGATTACGCTCATATGACAAGTTTGTAC and TCATCTGCAGCTCGAGACCACTTTGTACAA. The constructed libraries were sequenced using the Illumina Novaseq 6000 platform to generate raw data, following the manufacturer’s instructions by the company of ANNOROAD Biotech. Co., Ltd. (China). After quality control, about 34.5 GB of clean data were generated. According to the design principles (TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC-(NNK)20-TAAGACCCAACTTTCTTGTACAAAGTTGTGCGGCCGCC), 60bp random sequences were extracted from the clean data and translated into amino acid sequences using standard genetic codons. The translation was stopped from the first stop codon, and peptides less than five aa in length after translation were removed. Finally, we obtained 68,190,232 peptides in total and 3,359,176 peptides after removing redundancy. (table1)
</p>
<br>
<h3>Table 1: Statistics of sequencing results</h3>
@@ -139,9 +140,9 @@ After some time, E. coli will accumulate in areas without blue light. This is th
<mainclass="mainn myshadow"style="
margin-left: 1.3rem;">
<h2id="p-5">SOE PCR</h2>
<p>First, we simulated the structure of HACE2 based on the RBD with SARS-CoV-2 using UCSF Chimera and predicted the site of enhanced HACE2 For these sites, we designed corresponding primers to modify and synthesize the PCR productsWe recovered the pcr reaction solution and sequenced it to make sure that all the mutations were successful, then we recovered the fragments and constructed the vectors by infusion ligation. Finally we used the constructed vector to perform yeast two-hybrid, but unfortunately we found that the vector we designed did not show their ability to interact with each other in this way after performing yeast two-hybrid, so we communicated with the PI and wondered if the nls had not been added and thus no yeast two-hybrid did not show the results it should, so we modified the experiment again and gave our mutant sequence with the yeast nls fragment RGRGRGRGRGRGRGRGGYRGRARGFAPY*
<p>First, we simulated the structure of HACE2 based on the RBD with SARS-CoV-2 using UCSF Chimera and predicted the site of enhanced HACE2 For these sites, we designed corresponding primers to modify and synthesize the PCR productsWe recovered the pcr reaction solution and sequenced it to make sure that all the mutations were successful, then we recovered the fragments and constructed the vectors by infusion ligation. Finally we used the constructed vector to perform yeast two-hybrid, but unfortunately we found that the vector we designed did not show their ability to interact with each other in this way after performing yeast two-hybrid, so we communicated with the PI and wondered if the nls had not been added and thus no yeast two-hybrid did not show the results it should, so we modified the experiment again and gave our mutant sequence with the yeast nls fragment RGRGRGRGRGRGRGRGGYRGRARGFAPY*(Table3)
</p>
<h4>Table 1.ACE2 point mutation predicted enhancement sites</h4>
<h4>Table 3.ACE2 point mutation predicted enhancement sites</h4>
