From 3b561fa5a9614174b82e684a1ea271d48d90bd1a Mon Sep 17 00:00:00 2001
From: Zhefu Li <zf-li23@mails.tsinghua.edu.cn>
Date: Tue, 1 Oct 2024 10:56:11 +0000
Subject: [PATCH] Update model.html
---
wiki/pages/model.html | 111 +++++++++++++++++++++++++++++++++++++++---
1 file changed, 105 insertions(+), 6 deletions(-)
diff --git a/wiki/pages/model.html b/wiki/pages/model.html
index 637a73ff..740148d1 100644
--- a/wiki/pages/model.html
+++ b/wiki/pages/model.html
@@ -354,7 +354,7 @@
muscone in the intestine can be obtained in combination with experiment. Because
there is no animal experimental support, the data are manually drafted, and the calculation method
is more meaningful than the calculation results.</p>
- <button id="Button1" onclick="toggleCodeSnippet()">Expand the code</button>
+ <button id="Button1" onclick="toggleCodeSnippet1()">Inhalation.m</button>
<div id="codeSnippet1" class="code-snippet">
% Define parameters
@@ -438,7 +438,7 @@
end
</div>
<script>
- function toggleCodeSnippet() {
+ function toggleCodeSnippet1() {
var codeSnippet = document.getElementById("codeSnippet1");
var button = document.getElementById("Button1"); // 注æ„å˜é‡å通常使用å°å†™å¼€å¤´
if (codeSnippet.style.display === "none") {
@@ -511,7 +511,7 @@
widely recognized, especially in the field of protein structure prediction.</li>
<li>Nucleic acid sequence information in NCBI <a
href="https://www.ncbi.nlm.nih.gov/gene/258679">link</a></li>
- <button id="Button2" onclick="toggleCodeSnippet()">Expand the code</button>
+ <button id="Button2" onclick="toggleCodeSnippet2()">DNA sequence of Or5an6</button>
<div id="codeSnippet2" class="code-snippet">
>NC_000085.7:12371629-12372576 Mus musculus strain C57BL/6J chromosome 19, GRCm39
@@ -531,7 +531,7 @@
GATGTAAAAATAAGTGCTTTTCTCAGTGCCACTGTTAG
</div>
<script>
- function toggleCodeSnippet() {
+ function toggleCodeSnippet2() {
var codeSnippet = document.getElementById("codeSnippet2");
var button = document.getElementById("Button2"); // 注æ„å˜é‡å通常使用å°å†™å¼€å¤´
if (codeSnippet.style.display === "none") {
@@ -545,7 +545,7 @@
</script>
<li>Protein sequence information in Uniprot <a
href="https://www.uniprot.org/uniprotkb/Q8VFV4/entry#sequences">link</a></li>
- <button id="Button3" onclick="toggleCodeSnippet()">Expand the code</button>
+ <button id="Button3" onclick="toggleCodeSnippet3()">Protein sequence of Or5an6</button>
<div id="codeSnippet3" class="code-snippet">
>sp|Q8VFV4|O5AN6_MOUSE Olfactory receptor 5AN6 OS=Mus musculus OX=10090 GN=Or5an6
@@ -558,7 +558,7 @@
ALQRCKNKCFSQCHC
</div>
<script>
- function toggleCodeSnippet() {
+ function toggleCodeSnippet3() {
var codeSnippet = document.getElementById("codeSnippet3");
var button = document.getElementById("Button3"); // 注æ„å˜é‡å通常使用å°å†™å¼€å¤´
if (codeSnippet.style.display === "none") {
@@ -582,6 +582,105 @@
</div>
<p style="text-align: center; font-size: 0.9em; margin-top: 10px;">fig 6 Protein structure of MOR215-1
</p>
+ <h4>2. System Preparation:</h4>
+ <ul>
+ <li>To study how muscone binds to the receptor, molecular docking tools such as AutoDock and Vina
+ are used to determine potential binding conformations and obtain docking data:
+ <ul>
+ <li>Mac software installation: AutoDock, Vina, XQuartz, MGLTools,</li>
+ <li>The 32-bit version of MGLTools cannot be used directly on Mac, but can be opened using
+ <code>open /Users/Shared/MGLTools/1.5.7/bin/adt</code>
+ </li>
+ <li><a href="https://mp.weixin.qq.com/s/yDN5DCvEnQdPGEPXL4NAwA">AutoDock</a> generates PDBQD
+ files: <code>MOR215_1.pdbqt</code> and <code>muscone.pdbqt</code>
+ <ul>
+ <li>In the same directory: <code>adt</code>, <code>autodock4</code>,
+ <code>autogrid4</code>, <code>vina</code>
+ </li>
+ </ul>
+ </li>
+ <li><a href="https://mp.weixin.qq.com/s/R8V7Hvag2OqTn4tLz3hGhg">Vina</a> configures the
+ docking parameter file <code>config.txt</code> in the same directory as follows (based
+ on actual coordinates), runs the docking simulation, and generates the file
+ <code>muscure.pdbqt</code>. This file records the possible binding modes of muscone with
+ the receptor at the defined coordinate position and dimensions
+ (<code>size_x, size_y, size_z</code>).
+ <button id="Button4" onclick="toggleCodeSnippet4()">config.txt</button>
+
+ <div id="codeSnippet4" class="code-snippet">
+ receptor = MOR215_1.pdbqt
+ ligand = muscone.pdbqt
+ center_x = -0.112
+ center_y = -0.219
+ center_z = -2.092
+ size_x = 40
+ size_y = 40
+ size_z = 40
+ exhaustiveness= 8
+ out=muscure.pdbqt
+ </div>
+ <script>
+ function toggleCodeSnippet4() {
+ var codeSnippet = document.getElementById("codeSnippet4");
+ var button = document.getElementById("Button4"); // 注æ„å˜é‡å通常使用å°å†™å¼€å¤´
+ if (codeSnippet.style.display === "none") {
+ codeSnippet.style.display = "block";
+ button.textContent = "Collapse the code"; // 使用之å‰é€‰ä¸çš„按钮元ç´
+ } else {
+ codeSnippet.style.display = "none";
+ button.textContent = "Expand the code"; // 使用之å‰é€‰ä¸çš„按钮元ç´
+ }
+ }
+ </script>
+ <pre><code>./vina --config config.txt</code></pre>
+ Obtain <code>muscure.pdbqt</code>
+ </li>
+ </ul>
+ </li>
+ </ul>
+ <ul>
+ <li><strong>Visualization Structure Optimization and Inspection</strong>:
+ <ul>
+ <li>Use <a href="https://mp.weixin.qq.com/s/jPu-_iSX0h94Yxu3PO65zA">Pymol</a> to analyze the
+ generated docking structures, identify potential binding conformations, especially
+ focusing on interactions at amino acids Arg-51 and Tyr-271, and determine stable low
+ free energy conformations. Then extract this conformation as separate PDB files,
+ isolating <code>MOR.pdb</code> and <code>MUS.pdb</code>.
+ <ul>
+ <li>Open <code>muscure.pdbqt</code> and <code>MOR215-1.pdb</code></li>
+ <li>Select the appropriate conformation, display interactions
+ <code>Action - find - polar contacts - to any atoms</code>
+ </li>
+ <li>Add <code>Label</code>, export the image</li>
+ </ul>
+ </li>
+ <li>Alternative Conformations
+ <ul>
+ <li>Arg-51
+ <div class="image-container">
+ <img src="https://static.igem.wiki/teams/5187/wiki-model-fig/dock1.png"
+ alt="Arg-51" class="shadowed-image"
+ style="width: 100%; max-width: 1000px;">
+ </div>
+ <p style="text-align: center; font-size: 0.9em; margin-top: 10px;">fig 7
+ Alternative Conformation with Arg-51</p>
+ </li>
+ <li>Tyr-271
+ <div class="image-container">
+ <img src="https://static.igem.wiki/teams/5187/wiki-model-fig/dock2.png"
+ alt="Tyr-271" class="shadowed-image"
+ style="width: 100%; max-width: 1000px;">
+ </div>
+ <p style="text-align: center; font-size: 0.9em; margin-top: 10px;">fig 7
+ Alternative Conformation with Tyr-271</p>
+ </li>
+ <li>Select conformations with low free energy that are more likely, extract in pdb
+ format, isolating <code>MOR.pdb</code> and <code>MUS.pdb</code></li>
+ </ul>
+ </li>
+ </ul>
+ </li>
+ </ul>
</div>
</div>
--
GitLab