diff --git a/static/style.css b/static/style.css
index 0a15b2eca6ebfdd6e556eff8cc89781ba24f0e74..f615fbd2d4bf69581bec24a38cecf49462373110 100644
--- a/static/style.css
+++ b/static/style.css
@@ -100,6 +100,10 @@ a[href^="#ref"] { /* Styling all hyperlinks */
height: auto; /* Keeps the aspect ratio */
}
+.small-img-small{
+ width: 100%;
+}
+
/* Style for larger screens */
@media (min-width: 768px) { /* Adjust 768px to your breakpoint */
.responsive-img {
@@ -107,27 +111,47 @@ a[href^="#ref"] { /* Styling all hyperlinks */
}
}
+@media (max-width: 768px) {
+ .small-img-small{
+ width: 75%;
+ height: auto; /* Maintain aspect ratio */
+ margin: 0 auto; /* Center the image horizontally */
+ display: block; /* Make the image a block element for centering */
+ padding-bottom: 20px;
+ }
+}
+
+
+
/* Default style for smaller screens */
.responsive-img-smaller {
width: 100%;
height: auto; /* Keeps the aspect ratio */
}
+.responsive-img-supersmall {
+ width: 80%;
+ height: auto; /* Keeps the aspect ratio */
+}
+
/* Style for larger screens */
@media (min-width: 768px) { /* Adjust 768px to your breakpoint */
.responsive-img-smaller {
width: 50%;
}
+ .responsive-img-supersmall {
+ width: 30%;
+ }
}
/* Video styling */
.video-container {
position: relative;
- width: 560px; /* Default size for larger screens */
- max-width: 100%; /* Ensures it adapts to smaller screens */
- padding-top: 56.25%; /* 16:9 aspect ratio */
- margin: 0 auto; /* Center align */
+ width: 100%; /* Let width be responsive */
+ max-width: 560px; /* Limit maximum width to match desired size on large screens */
+ aspect-ratio: 16 / 9; /* Maintain a perfect 16:9 aspect ratio */
overflow: hidden;
+ margin-bottom:10px;
}
.video-container iframe {
@@ -564,7 +588,8 @@ a[href^="#ref"] { /* Styling all hyperlinks */
@media (max-width: 480px) {
#animation-container {
height: 300px;
- margin-top: 50px;
+ margin-top: 350px;
+ padding-top: 100px;
background-size: cover;
background-position: top;
}
@@ -1157,10 +1182,12 @@ header {
margin: 0 auto; /* Center the content */
}
-
-
-
-
+ .page-container {
+ flex-direction: column; /* Stack elements vertically */
+ width: 100%; /* Full width on smaller screens */
+ padding: 0; /* Remove unnecessary padding for smaller screens */
+ }
+
}
@@ -1717,26 +1744,74 @@ html {
margin: 0 0 auto 15px; /* Adds spacing between logos */
}
-/* Default icon size for larger screens */
+.social-icons {
+ justify-content: center; /* Ensure icons stay centered horizontally */
+ margin: 0 auto; /* Center the container on the page */
+ gap: 50px; /* Add more space between icons for clarity */
+}
+
.social-icons img {
- width: 30px;
- vertical-align: middle;
- filter: invert(100%) brightness(200%);
+ width: 45px; /* Default size of icons */
+ height: auto; /* Maintain aspect ratio */
+ filter: invert(100%) brightness(200%); /* Ensure proper coloring */
+ transition: transform 0.3s ease; /* Smooth hover effect */
+}
+
+.social-icons img:hover {
+ transform: scale(1.2); /* Slightly enlarge the icon on hover */
}
+.footer-centered {
+ display: flex;
+ flex-direction: column; /* Stack items vertically */
+ gap: 10px; /* Add space between items */
+}
+
+
+
/* For smaller screens (phones) */
@media (max-width: 768px) {
- .social-icons img {
- width: 20px; /* Reduce icon size on smaller screens */
+ .social-icons {
+ justify-content: center; /* Ensure icons stay centered horizontally */
+ margin: 0 auto; /* Center the container on the page */
+ gap: 60px; /* Add more space between icons for clarity */
+ align-items: center; /* Horizontally center the content */
+ text-align: center; /* Ensure text is centered */
}
-}
-/* For even smaller screens (very small phones) */
-@media (max-width: 480px) {
.social-icons img {
- width: 15px; /* Further reduce icon size on very small screens */
+ width: 40px; /* Slightly reduce size for smaller screens */
+ margin-right: 0; /* Remove right margin for icons */
+ margin-bottom: 5px; /* Add spacing under icons */
+ }
+
+ .sponsor-logo {
+ margin: 15px auto; /* Ensures logos are centered on medium-small screens */
+ text-align: center; /* Centers content if needed */
+ }
+
+ .footer h4 {
+ text-align: center; /* Ensure titles stay centered on very small screens */
+ }
+
+ .footer-centered {
+ align-items: center; /* Horizontally center the content */
+ text-align: center; /* Ensure text is centered */
+ }
+
+ .footer-centered div {
+ justify-content: center; /* Center each individual block */
+ }
+
+ .footer-centered img {
+ margin-right: 0; /* Remove right margin for icons */
+ margin-bottom: 5px; /* Add spacing under icons */
}
}
+
+
+
+
diff --git a/static/team_page.js b/static/team_page.js
index fb03643f75a31ec3ecfc6db47485f49675601b52..6c00147b6e00c126bd5610110fed298a4237ac1e 100644
--- a/static/team_page.js
+++ b/static/team_page.js
@@ -180,7 +180,7 @@ document.addEventListener('DOMContentLoaded', function() {
{
name: "Julia Wyss",
roles: ["SBL iGEM"],
- description: "Julia completed her Bachelor’s degree in Biomedicine and participated in the iGEM UZurich 2023 team. She is the SBL board member responsible for iGEM teams. She loves traveling to explore new countries and spending time in the mountains.",
+ description: "Julia completed her Bachelor’s degree in Biomedicine and participated in the iGEM UZurich 2023 team. She is the Student Biolab Zurich board member responsible for iGEM teams. She loves traveling to explore new countries and spending time in the mountains.",
image: "https://static.igem.wiki/teams/5250/team-members/img-14-min.png"
},
{
@@ -193,7 +193,7 @@ document.addEventListener('DOMContentLoaded', function() {
name: "Atilla Schreiber",
roles: ["Advisor Dry Lab"],
description: "Atilla participated in iGEM UZurich 2022. He is a master student in <i>Neural Systems and Computation</i> at the University of Zurich. We look forward to enjoying some chatty ping pong matches and fun bouldering sessions with him once the project wraps up!",
- image: "https://static.igem.wiki/teams/5250/team-members/img-16-min.png"
+ image: "https://static.igem.wiki/teams/5250/team-members/img-17-neu.webp"
}
];
diff --git a/static/toc.js b/static/toc.js
index 9103bea481ffec4bc1554e12ee0cf1b20dcd75de..022f66e7daa6c6baddb76fe7a3c71abd98bd8490 100644
--- a/static/toc.js
+++ b/static/toc.js
@@ -1,87 +1,126 @@
document.addEventListener("DOMContentLoaded", function() {
- const tocToggle = document.getElementById("toc-toggle");
- const toc = document.getElementById("toc");
- const tocClose = document.getElementById("toc-close");
-
- // Fixed heights (have to be adjusted in case menu or toctoggle height is changed)
- const menuHeight = 100; // Height of the fixed menu, I added a bit more to give more space
- const tocToggleHeight = 40; // Height of the TOC toggle bar
-
- // Handle TOC toggle on small screens only
- tocToggle.addEventListener("click", function() {
- if (window.innerWidth <= 767.98) {
- toc.classList.add("active");
- }
- });
-
- tocClose.addEventListener("click", function() {
- toc.classList.remove("active");
- });
-
- const tocList = document.getElementById("toc-list");
- tocList.innerHTML = ''; // Clear any existing TOC items
-
- // Select only the headers that should be included in the TOC
- const headers = document.querySelectorAll("main h2, main h3, main h4");
- const tocItems = [];
-
- headers.forEach((header, index) => {
- const id = `section-${index}`;
- header.setAttribute("id", id);
-
- const tocItem = document.createElement("li");
- tocItem.classList.add("nav-item");
-
- let indent = ''; // Add indentation based on header level
- if (header.tagName === 'H3') {
- indent = 'pl-3'; // Add padding for <h3>
- } else if (header.tagName === 'H4') {
- indent = 'pl-5'; // Add more padding for <h4>
- }
-
- tocItem.innerHTML = `<a class="nav-link ${indent}" href="#${id}">${header.innerText}</a>`;
- tocList.appendChild(tocItem);
- tocItems.push(tocItem);
- });
-
- // Adjust the scroll offset to prevent content from hiding behind the menu and TOC
- document.querySelectorAll('#toc-list a').forEach(anchor => {
- anchor.addEventListener('click', function(e) {
- e.preventDefault();
-
- const targetId = this.getAttribute('href').substring(1);
- const targetElement = document.getElementById(targetId);
-
- // Calculate the fixed offset taking into account the menu and TOC toggle height
- const fixedOffset = menuHeight + tocToggleHeight;
-
- window.scrollTo({
- top: window.scrollY + targetElement.getBoundingClientRect().top - fixedOffset,
- behavior: 'smooth'
- });
-
- // Close TOC if it's on a small screen
- if (window.innerWidth <= 767.98) {
+ const tocToggle = document.getElementById("toc-toggle");
+ const toc = document.getElementById("toc");
+ const tocClose = document.getElementById("toc-close");
+
+ const menuHeight = 100; // Adjust this to match your header height
+ const tocToggleHeight = 40; // Adjust this if your TOC toggle height changes
+ const fixedOffset = menuHeight + tocToggleHeight;
+
+ tocToggle.addEventListener("click", function() {
+ if (window.innerWidth <= 767.98) {
+ toc.classList.add("active");
+ }
+ });
+
+ tocClose.addEventListener("click", function() {
toc.classList.remove("active");
- }
});
- });
-
- // Highlight the current section in the TOC
- document.addEventListener("scroll", function() {
- let currentSection = headers[0];
- headers.forEach(header => {
- const headerTop = header.getBoundingClientRect().top;
- if (headerTop <= 150) {
- currentSection = header;
- }
+
+ const tocList = document.getElementById("toc-list");
+ tocList.innerHTML = ''; // Clear any existing TOC items
+
+ const headers = document.querySelectorAll("main h2, main h3, main h4");
+ const tocItems = [];
+ const tocStack = [];
+
+ headers.forEach((header, index) => {
+ const id = `section-${index}`;
+ header.setAttribute("id", id);
+
+ const tocItem = document.createElement("li");
+ tocItem.classList.add("nav-item");
+
+ let indent = '';
+ if (header.tagName === 'H3') {
+ indent = 'pl-3';
+ } else if (header.tagName === 'H4') {
+ indent = 'pl-5';
+ }
+
+ tocItem.innerHTML = `<a class="nav-link ${indent} ${header.tagName.toLowerCase()}" href="#${id}"><span>${header.innerText}</span></a>`;
+
+ if (header.tagName === 'H2') {
+ // Handle H2 separately, reset stack
+ tocStack.length = 0;
+ tocStack.push(tocItem);
+ tocList.appendChild(tocItem);
+ } else if (header.tagName === 'H3') {
+ // H3 should always be a child of the last H2
+ let lastH2Item = tocStack[0];
+ let nestedList = lastH2Item.querySelector('.nested');
+ if (!nestedList) {
+ nestedList = document.createElement("ul");
+ nestedList.classList.add("nested");
+ lastH2Item.appendChild(nestedList);
+ }
+ nestedList.appendChild(tocItem);
+ tocStack[1] = tocItem; // Update tocStack for H3
+ } else if (header.tagName === 'H4') {
+ // H4 should always be a child of the last H3
+ let lastH3Item = tocStack[1];
+ let nestedList = lastH3Item.querySelector('.nested');
+ if (!nestedList) {
+ nestedList = document.createElement("ul");
+ nestedList.classList.add("nested");
+ lastH3Item.appendChild(nestedList);
+ }
+ nestedList.appendChild(tocItem);
+ }
+
+ tocItems.push(tocItem);
+ });
+
+ tocList.addEventListener('click', function(e) {
+ const target = e.target.closest('.nav-item > a');
+ if (target) {
+ const nested = target.nextElementSibling;
+ if (nested && nested.classList.contains('nested')) {
+ e.preventDefault();
+ nested.classList.toggle('active');
+ }
+ }
+ });
+
+ // Adjust scrolling for internal content links
+ document.querySelectorAll('a[href^="#"]').forEach(anchor => {
+ anchor.addEventListener('click', function(e) {
+ const targetId = this.getAttribute('href').substring(1);
+ const targetElement = document.getElementById(targetId);
+
+ if (targetElement) {
+ e.preventDefault();
+
+ const elementPosition = targetElement.getBoundingClientRect().top + window.scrollY;
+ const offsetPosition = elementPosition - fixedOffset;
+
+ window.scrollTo({
+ top: offsetPosition,
+ behavior: 'smooth'
+ });
+
+ // Automatically close the TOC after clicking a section header
+ if (window.innerWidth <= 767.98) {
+ toc.classList.remove("active");
+ }
+ }
+ });
});
- tocItems.forEach(item => {
- item.firstChild.classList.remove("active");
- if (item.firstChild.getAttribute("href").substring(1) === currentSection.getAttribute("id")) {
- item.firstChild.classList.add("active");
- }
+ document.addEventListener("scroll", function() {
+ let currentSection = headers[0];
+ headers.forEach(header => {
+ const headerTop = header.getBoundingClientRect().top;
+ if (headerTop <= 150) {
+ currentSection = header;
+ }
+ });
+
+ tocItems.forEach(item => {
+ item.firstChild.classList.remove("active");
+ if (item.firstChild.getAttribute("href").substring(1) === currentSection.getAttribute("id")) {
+ item.firstChild.classList.add("active");
+ }
+ });
});
- });
});
diff --git a/static/toc2.js b/static/toc2.js
deleted file mode 100644
index 022f66e7daa6c6baddb76fe7a3c71abd98bd8490..0000000000000000000000000000000000000000
--- a/static/toc2.js
+++ /dev/null
@@ -1,126 +0,0 @@
-document.addEventListener("DOMContentLoaded", function() {
- const tocToggle = document.getElementById("toc-toggle");
- const toc = document.getElementById("toc");
- const tocClose = document.getElementById("toc-close");
-
- const menuHeight = 100; // Adjust this to match your header height
- const tocToggleHeight = 40; // Adjust this if your TOC toggle height changes
- const fixedOffset = menuHeight + tocToggleHeight;
-
- tocToggle.addEventListener("click", function() {
- if (window.innerWidth <= 767.98) {
- toc.classList.add("active");
- }
- });
-
- tocClose.addEventListener("click", function() {
- toc.classList.remove("active");
- });
-
- const tocList = document.getElementById("toc-list");
- tocList.innerHTML = ''; // Clear any existing TOC items
-
- const headers = document.querySelectorAll("main h2, main h3, main h4");
- const tocItems = [];
- const tocStack = [];
-
- headers.forEach((header, index) => {
- const id = `section-${index}`;
- header.setAttribute("id", id);
-
- const tocItem = document.createElement("li");
- tocItem.classList.add("nav-item");
-
- let indent = '';
- if (header.tagName === 'H3') {
- indent = 'pl-3';
- } else if (header.tagName === 'H4') {
- indent = 'pl-5';
- }
-
- tocItem.innerHTML = `<a class="nav-link ${indent} ${header.tagName.toLowerCase()}" href="#${id}"><span>${header.innerText}</span></a>`;
-
- if (header.tagName === 'H2') {
- // Handle H2 separately, reset stack
- tocStack.length = 0;
- tocStack.push(tocItem);
- tocList.appendChild(tocItem);
- } else if (header.tagName === 'H3') {
- // H3 should always be a child of the last H2
- let lastH2Item = tocStack[0];
- let nestedList = lastH2Item.querySelector('.nested');
- if (!nestedList) {
- nestedList = document.createElement("ul");
- nestedList.classList.add("nested");
- lastH2Item.appendChild(nestedList);
- }
- nestedList.appendChild(tocItem);
- tocStack[1] = tocItem; // Update tocStack for H3
- } else if (header.tagName === 'H4') {
- // H4 should always be a child of the last H3
- let lastH3Item = tocStack[1];
- let nestedList = lastH3Item.querySelector('.nested');
- if (!nestedList) {
- nestedList = document.createElement("ul");
- nestedList.classList.add("nested");
- lastH3Item.appendChild(nestedList);
- }
- nestedList.appendChild(tocItem);
- }
-
- tocItems.push(tocItem);
- });
-
- tocList.addEventListener('click', function(e) {
- const target = e.target.closest('.nav-item > a');
- if (target) {
- const nested = target.nextElementSibling;
- if (nested && nested.classList.contains('nested')) {
- e.preventDefault();
- nested.classList.toggle('active');
- }
- }
- });
-
- // Adjust scrolling for internal content links
- document.querySelectorAll('a[href^="#"]').forEach(anchor => {
- anchor.addEventListener('click', function(e) {
- const targetId = this.getAttribute('href').substring(1);
- const targetElement = document.getElementById(targetId);
-
- if (targetElement) {
- e.preventDefault();
-
- const elementPosition = targetElement.getBoundingClientRect().top + window.scrollY;
- const offsetPosition = elementPosition - fixedOffset;
-
- window.scrollTo({
- top: offsetPosition,
- behavior: 'smooth'
- });
-
- // Automatically close the TOC after clicking a section header
- if (window.innerWidth <= 767.98) {
- toc.classList.remove("active");
- }
- }
- });
- });
-
- document.addEventListener("scroll", function() {
- let currentSection = headers[0];
- headers.forEach(header => {
- const headerTop = header.getBoundingClientRect().top;
- if (headerTop <= 150) {
- currentSection = header;
- }
- });
-
- tocItems.forEach(item => {
- item.firstChild.classList.remove("active");
- if (item.firstChild.getAttribute("href").substring(1) === currentSection.getAttribute("id")) {
- item.firstChild.classList.add("active");
- }
- });
- });
-});
diff --git a/wiki/footer.html b/wiki/footer.html
index 1d670e4b6ab810d3422fedf3cea4ef34738b7129..18ad11defd3a852cfbf6c719276acdb95e172c5a 100644
--- a/wiki/footer.html
+++ b/wiki/footer.html
@@ -83,38 +83,38 @@
<div class="row mt-4"></div>
<img src="https://static.igem.wiki/teams/5250/logos/igem-logo-transparent-white.png" alt="igemuzh logo" class=" sponsor-logo left-aligned">
<!-- Location and Mail Section -->
- <div style="display: flex; flex-direction: column; gap: 10px;">
+ <div class="footer-centered">
<!-- Location -->
<div style="display: flex; align-items: center;">
<a href="https://www.google.ch/maps/place/University+of+Zurich+Irchel/@47.397897,8.5460004,16.81z/data=!4m6!3m5!1s0x479075e14a42a495:0xf48062e7447ad0c2!8m2!3d47.3978672!4d8.5483563!16s%2Fg%2F1tg5t07z?entry=ttu" target="_blank" rel="noopener noreferrer" style="text-decoration: none">
<img src="https://static.igem.wiki/teams/5250/logos/geo-alt-fill.svg" alt="Location" style="width: 30px; vertical-align: middle; filter: invert(100%) brightness(200%); margin-right: 10px;">
+ <span>University of Zurich, Campus Irchel</span>
</a>
- <span>University of Zurich, Campus Irchel</span>
</div>
<!-- Mail -->
<div style="display: flex; align-items: center;">
<a href="mailto:igemuzh@studentbiolab.ch/" target="_blank" rel="noopener noreferrer" style="text-decoration: none">
<img src="https://static.igem.wiki/teams/5250/logos/envelope-at.svg" alt="Mail" style="width: 30px; vertical-align: middle; filter: invert(100%) brightness(200%); margin-right: 10px;">
+ <span>igemuzh@studentbiolab.ch</span>
</a>
- <span>igemuzh@studentbiolab.ch</span>
</div>
-
</div>
<!-- Follow Us Section -->
+ <div class="row mt-4"></div>
<h4 class="mt-lg-4 mt-sm-4 mb-2">Follow us</h4>
- <div class="row mt-2"></div>
+ <div class="row mt-4"></div>
<div class="social-icons">
<!-- Instagram -->
- <a href="https://www.instagram.com/igem_uzurich/" target="_blank" rel="noopener noreferrer" style="text-decoration: none">
- <img src="https://static.igem.wiki/teams/5250/logos/instagram.svg" alt="Instagram" style="width: 30px; vertical-align: middle; filter: invert(100%) brightness(200%);">
+ <a href="https://www.instagram.com/igem_uzurich/" target="_blank" rel="noopener noreferrer">
+ <img src="https://static.igem.wiki/teams/5250/logos/instagram.svg" alt="Instagram">
</a>
<!-- Youtube -->
- <a href="https://www.youtube.com/@igemuzurich442" target="_blank" rel="noopener noreferrer" style="text-decoration: none">
- <img src="https://static.igem.wiki/teams/5250/logos/youtube.svg" alt="Youtube" style="width: 30px; vertical-align: middle; filter: invert(100%) brightness(200%);">
+ <a href="https://www.youtube.com/@igemuzurich442" target="_blank" rel="noopener noreferrer">
+ <img src="https://static.igem.wiki/teams/5250/logos/youtube.svg" alt="Youtube">
</a>
</div>
</div>
diff --git a/wiki/layout_TOC.html b/wiki/layout_TOC.html
index 0d4cf0ff7938c37c5b1e25e56ee2c8ed205256a7..d22791e2c056cd3dc3d91c067786611c70f7d2d3 100644
--- a/wiki/layout_TOC.html
+++ b/wiki/layout_TOC.html
@@ -14,19 +14,6 @@
<!-- Custom CSS -->
<link href="{{ url_for('static', filename='style.css') }}" rel="stylesheet">
- <!-- Custom global styles -->
- <style>
- /* Make images appear smaller on small screens */
- @media (max-width: 576px) {
- .col-lg-4 img, .col-md-6 img, .col-sm-12 img {
- width: 70% !important; /* Ensure it overrides other styles */
- height: auto; /* Maintain aspect ratio */
- margin: 0 auto; /* Center the image horizontally */
- display: block; /* Make the image a block element for centering */
- padding-bottom: 20px;
- }
- }
- </style>
<title>{% block title %}{% endblock %} | UZurich - iGEM 2024</title>
@@ -82,7 +69,7 @@
<!-- Bootstrap Bundle with Popper -->
<script src="{{ url_for('static', filename='bootstrap.bundle.min.js') }}"></script>
<!-- Custom JS -->
- <script src="{{ url_for('static', filename='toc2.js') }}"></script>
+ <script src="{{ url_for('static', filename='toc.js') }}"></script>
<!-- Custom JS for Scroll Progress Bar -->
diff --git a/wiki/pages/awards.html b/wiki/pages/awards.html
index 87c3b405a9135b07ef9f4904d2a262db1a3fd128..095ed22ed99dd4ef681bb0ce0531019372e0e5eb 100644
--- a/wiki/pages/awards.html
+++ b/wiki/pages/awards.html
@@ -4,13 +4,46 @@
{% block title %}{% endblock %}
{% block page_content %}
-<div class="row">
- <p>
- The iGEM UZurich team is thrilled for the Jamboree in Paris from October 23-26! <br>
- Stay tuned to find out if our project impressed the judges and earned us any nominations or awards.
- </p>
+
+<div class="highlight" style="display: flex; flex-direction: column;align-items: center;justify-content: center;text-align: center;" >
+ <div class="row mt-4">
+ <h4>
+ At the Grand Jamboree in Paris from October 23-26 2024, the iGEM UZurich team 2024 was able to achieve the following:
+ </h4>
+ </div>
+ <div class="row mt-4">
+ <div class="col-lg-6 col-sm-12">
+ <h3>
+ <img src="https://static.igem.wiki/teams/5250/awards/gold-medal.webp" alt="Gold medal" style="width: 40px; height: 40px; margin-right: 4px;">
+ Awards:
+ </h3>
+ <h5>
+ Gold Medal <br>
+ <a href="{{ url_for('pages', page='sustainable') }}" class="hyperlink-under">Best Sustainable Development Impact, Overgrad</a>
+ </h5>
+ </div>
+ <div class="col-lg-6 col-sm-12">
+ <h3>
+ <img src="https://static.igem.wiki/teams/5250/awards/achievement-silver.webp" alt="Silver achievement" style="width: 40px; height: 40px; margin-right: 4px;">
+ Nominations:
+ </h3>
+ <h5>
+ Best Agriculture Project, Undergrad & Overgrad <br>
+ Best Wiki, Overgrad
+ </h5>
+ </div>
+ </div>
+ <div class="row mt-2">
+ <img src="https://static.igem.wiki/teams/5250/awards/igem-09112024-photos121-02.webp" alt="Jamboree with award for Best Sustainable Development" class="img-fluid responsive-img" style="display: block; margin: 0 auto;">
+ </div>
+ <div class="row mt-5">
+ <h4> We are very pleased with our achievements and would like to thank everyone who has followed and supported us along the way!</h4>
+ </div>
+ <div class="row mt-5"></div>
</div>
+
+
<div class="row mt-4">
<h2>Medal Requirements</h2>
<hr>
@@ -20,36 +53,36 @@
<!-- Bronze medal -->
<div class="row">
<div class="col-lg-3 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>Competition Deliverables</h3>
- <p>We have completed and submitted all required deliverables, except for the presentation video, which will be uploaded on October 9, and the judging session, which will take place at the Jamboree.
+ <p>We have completed and submitted all required deliverables.
<ul>
- <li>Wiki <a href="{{ url_for('pages', page='home') }}" class="hyperlink-button">Wiki</a></li>
- <li>Presentation Video (not uploaded yet)</li>
+ <li><a href="{{ url_for('pages', page='home') }}" class="hyperlink-button">Wiki</a></li>
+ <li><a href="https://teams.igem.org/5250/safety/74a59fdc-35c7-4567-86fd-3bea339286b0" class="hyperlink-button">Presentation Video</a></li>
<li>Judging Form</li>
- <li>Judging Session (pending)</li>
+ <li>Judging Session</li>
</ul>
</p>
</div>
</div>
<div class="col-lg-3 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>Project Attributions</h3>
- <p>All the contributions made by our team members are explained in detail and the support provided by our instructors, PIs, advisors, and external contributors is acknowledged and explained on the attribution form and wiki page.</p>
- <a href="{{ url_for('pages', page='attributions') }}" class="hyperlink-button"> See Attributions</a>
+ <p>All the contributions made by our team members are described in detail and the support provided by our instructors, PIs, advisors, and external contributors is acknowledged and explained on the attribution form and wiki page.</p>
+ <a href="{{ url_for('pages', page='attributions') }}" class="hyperlink-button">See Attributions</a>
</div>
</div>
<div class="col-lg-3 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>Project Description</h3>
<p>On our project description page, we explain what the goal of our project RhyzUp is, why it’s a useful application of synthetic biology, and what inspired us.</p>
<a href="{{ url_for('pages', page='description') }}" class="hyperlink-button">See Project Description</a>
</div>
</div>
<div class="col-lg-3 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>Contribution</h3>
- <p>On our contribution wiki page, we list what contributions we made for future iGEM teams.</p>
+ <p>On our contribution wiki page, we list what contributions the 2024 UZurich iGEM team made for future iGEM teams.</p>
<a href="{{ url_for('pages', page='contribution') }}" class="hyperlink-button"> See Contributions</a>
</div>
</div>
@@ -61,19 +94,19 @@
</div>
<div class="row">
- <div class="col-lg-6 col-md-6 col-sm-12">
- <div class="award-box" style="height: 400px;">
+ <div class="col-lg-4 col-md-6 col-sm-12">
+ <div class="award-box">
<h3>Engineering Success</h3>
<p>
- On our Engineering page (link), we present our engineering design cycles, describe the process of designing, building, and testing our components, as well as the lessons we learned from each iteration.
+ On our Engineering page, we present our engineering design cycles, describe the process of designing, building, and testing our components, as well as the lessons we learned from each iteration.
</p>
- <a href="{{ url_for('pages', page='engineering') }}" class="hyperlink-button"> See Engineering</a>
+ <a href="{{ url_for('pages', page='engineering') }}" class="hyperlink-button">See Engineering</a>
</div>
</div>
- <div class="col-lg-6 col-md-6 col-sm-12">
- <div class="award-box" style="height: 400px;">
+ <div class="col-lg-8 col-md-6 col-sm-12">
+ <div class="award-box">
<h3>Human Practices</h3>
<p>
Our Human Practices page highlights the work of the Human Practices subteam, which consulted with various stakeholders to understand how our project contributes to the United Nations' 17 Sustainable Development Goals (SDGs).
@@ -96,7 +129,7 @@
<div class="row">
<div class="col-lg-4 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>
<img src="https://static.igem.wiki/teams/5250/logos/eyedropper.svg" alt="icon" style="width: 24px; height: 24px; margin-right: 8px;">
New Basic Part
@@ -111,7 +144,7 @@
</div>
</div>
<div class="col-lg-4 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>
<img src="https://static.igem.wiki/teams/5250/logos/people.svg" alt="icon" style="width: 24px; height: 24px; margin-right: 8px;">
Sustainable Development
@@ -126,7 +159,7 @@
</div>
</div>
<div class="col-lg-4 col-md-6 col-sm-12">
- <div class="award-box" style="height: 500px;">
+ <div class="award-box">
<h3>
<img src="https://static.igem.wiki/teams/5250/logos/laptop.svg" alt="icon" style="width: 24px; height: 24px; margin-right: 8px;">
Model
@@ -139,6 +172,18 @@
</div>
</div>
</div>
-
+<div class="row mt-4"></div>
+<div class="highlight" style="display: flex; flex-direction: column;align-items: center;justify-content: center;text-align: center;" >
+ <div class="row mt-4">
+ <img src="https://static.igem.wiki/teams/5250/awards/collage.webp" alt="Pics of team during iGEM journey" class="img-fluid responsive-img" style="display: block; margin: 0 auto;">
+ </div>
+ <div class="row mt-5">
+ <h4>
+ We are very pleased with what we have achieved and would like to thank everyone who has followed and supported us along the way!<br>
+ It has really been an amazing experience and we have had a lot of fun with this project <3.
+ </h4>
+ </div>
+ <div class="row mt-5"></div>
+</div>
{% endblock %}
diff --git a/wiki/pages/contribution.html b/wiki/pages/contribution.html
index 000f1a1be35c97c3c5d6b8d3269db5eb9e41a82a..8ea8b898c4470f9aaa7042c52a2caf0ab901099b 100644
--- a/wiki/pages/contribution.html
+++ b/wiki/pages/contribution.html
@@ -67,7 +67,7 @@
<hr>
<h3>Model</h3>
<p>
- <a href="{{ url_for('pages', page='results') }}" class="hyperlink-under">Our Model page </a> can be used as a guide for planning a similar flux balance analysis (FBA) with a focus on biofilm production.
+ Our <a href="{{ url_for('pages', page='results') }}" class="hyperlink-under">Model page </a> can be used as a guide for planning a similar flux balance analysis (FBA) with a focus on biofilm production.
It explains how to design and implement in silico experiments in an adapted model.
The FBA explanation example, the code, and references are particularly useful for future teams to get started with constructing a model.
This further enhances the collective knowledge of iGEM.
@@ -82,7 +82,7 @@
<h3>Wiki:</h3>
<p>
We made an effort to code as clearly as possible, and to comment on crucial parts of our code, so that future teams can use it as a guide on how to get from the template to a finished wiki.
- Custom features such as the “flipping cards†(<a href="{{ url_for('pages', page='team') }}" class="hyperlink-under">see Team page </a>) and “scrollable timeline†(<a href="{{ url_for('pages', page='notebook') }}" class="hyperlink-under">see Notebook </a>) could be of interest to future wikis as well.
+ Custom features such as the “flipping cards†(<a href="{{ url_for('pages', page='team') }}" class="hyperlink-under">see Team page</a>) and “scrollable timeline†(<a href="{{ url_for('pages', page='notebook') }}" class="hyperlink-under">see Notebook</a>) could be of interest to future wikis as well.
</p>
</div>
</div>
@@ -133,7 +133,7 @@
<p>
For the Swiss iGEM meetup we organized for the EPFL Lausanne, the University of Lausanne, the ETH Zürich, and our own University of Zurich team, we planned a scavenger hunt through Zurich.
During this scavenger hunt, any number of groups compete by solving six riddles that lead them to historic locations all around Zurich. <br>
- The protocol for the scavenger hunt is <a href="{{ url_for('pages', page='collaboration') }}#scavenger" class="hyperlink-under">uploaded to our Wiki</a> and can easily be adapted for anyone interested in playing the game.
+ The <a href="{{ url_for('pages', page='collaboration') }}#scavenger" class="hyperlink-under">protocol for the scavenger hunt is uploaded to our wiki</a> and can easily be adapted for anyone interested in playing the game.
Besides the document containing all riddles, there is a document with the solutions to the riddles.
</p>
<p>
diff --git a/wiki/pages/description.html b/wiki/pages/description.html
index 0e995ba6ad159af1971798cc45bce45e1acf8275..9142a7a0dffe29b3e41c214f79227cb3d124abbb 100644
--- a/wiki/pages/description.html
+++ b/wiki/pages/description.html
@@ -25,7 +25,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/project-description/food-pic.png" alt="Agriculture picture" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/project-description/food-pic.png" alt="Agriculture picture" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -57,7 +57,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/project-description/igem-bacteria-and-plant-children.png" alt="Our mascot" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/project-description/igem-bacteria-and-plant-children.png" alt="Our mascot" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -145,7 +145,7 @@
<div class="col-lg-12">
<h2>Watch Our Presentation Video</h2>
<hr>
- <div class="video-container">
+ <div class="video-container" style="display: block; margin: auto;">
<iframe src="https://video.igem.org/videos/embed/b2a999ad-14d2-4a4e-b0cb-b9fc67681cf5" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
</div>
</div>
diff --git a/wiki/pages/education.html b/wiki/pages/education.html
index 5ba7222f2b1e959342b72a5e16f947d3cce21a61..20c1cbd11b57d4209650eb69274cc480f0cdfd67 100644
--- a/wiki/pages/education.html
+++ b/wiki/pages/education.html
@@ -15,7 +15,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-01.jpg" alt="Education" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-01.jpg" alt="Education" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
@@ -49,7 +49,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-02.jpg" alt="School Lessons" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-02.jpg" alt="School Lessons" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -85,7 +85,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-03.jpg" alt="Education" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-03.jpg" alt="Education" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
@@ -119,7 +119,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-04.jpg" alt="Visit Agroscope" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-04.jpg" alt="Visit Agroscope" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -155,7 +155,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-06.jpg" alt="Science and nature festival" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-06.jpg" alt="Science and nature festival" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -174,8 +174,8 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-07-min.jpg" alt="Lab Workshop" class="img-fluid" style="width: 100%;">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-08-min.jpg" alt="Lab Workshop" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-07-min.jpg" alt="Lab Workshop" class="img-fluid small-img-small">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-08-min.jpg" alt="Lab Workshop" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -207,7 +207,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-6 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-09-min.jpg" alt="Exhibition" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/education/img-09-min.jpg" alt="Exhibition" class="img-fluid small-img-small">
</div>
<div class="col-lg-6 col-md-6 col-sm-12 order-2 order-md-1">
<p>
diff --git a/wiki/pages/engineering.html b/wiki/pages/engineering.html
index 5084bdecec7876e9abd1aa9defef1273fca9149d..36716da9c68bf51dd170c2d2e361f52046ded4f6 100644
--- a/wiki/pages/engineering.html
+++ b/wiki/pages/engineering.html
@@ -41,7 +41,7 @@
</p>
<p>
We chose Golden Gate Assembly for our cloning method.
- The iGEM distribution kit supplied us with basic parts, such as constitutive promoters, different ribosome binding sites (RBS), GFP and a terminator (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">refer to parts for more details</a>).
+ The iGEM distribution kit supplied us with basic parts, such as constitutive promoters, different ribosome binding sites (RBS), GFP and a terminator (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">see Parts for more details</a>).
We also utilized several of the provided backbones: pJUMP28-1A, pJUMP23-1A,pJUMP28-1B, pJUMP29-1C, pJUMP29-1D, pJUMP43-2A and pJUMP45-2A.
</p>
<p>
@@ -97,11 +97,11 @@
<h4>Design and Build</h4>
<p>
Due to a misunderstanding when reading the paper, we thought the XutR complex would bind to the PXut directly.
- To test the functionality of the PXut, we therefore assembled the level 2 testing plasmid pT12Rhyz01 (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">refer to Parts for more details</a>) without the operator sequence after the PXut.
+ To test the functionality of the PXut, we therefore assembled the level 2 testing plasmid pT12Rhyz01 (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">see Parts for more details</a>) without the operator sequence after the PXut.
pT12Rhyz01 consists of pT11Rhyz01, pT11Rhyz02 and two linker transcription units.
The xylose-binding protein XutR is constitutively expressed using the promoter BBa_J23119 on the first transcription unit, since we don’t want the promoter’s activation to be limited due to the insufficient expression of XutR but rather due to the presence or absence of xylose.
The second transcription unit encodes the xylose-induced promoter (PXut) and a GFP (without the operator sequence).
- We introduced the pT12Rhyz01 plasmid into <i>E. coli</i> SY327 and then transferred pT12Rhyz01 into <i>Pseudomonas sp.</i> IsoF using Triparental Conjugation (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">refer to experiment for more details</a>).
+ We introduced the pT12Rhyz01 plasmid into <i>E. coli</i> SY327 and then transferred pT12Rhyz01 into <i>Pseudomonas sp.</i> IsoF using Triparental Conjugation (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>).
</p>
</div>
<div class="row mt-4">
@@ -116,7 +116,7 @@
They were induced with the different xylose concentrations and kept for 8 hours at room temperature.
Each strain was tested in triplicate.
The GFP expression was then measured every hour for a total of 15 hours.
- This sensing assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">refer to experiment for more details</a>) failed, there was no increase in GFP when higher xylose concentrations were present.
+ This sensing assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>) failed, there was no increase in GFP when higher xylose concentrations were present.
</p>
</div>
@@ -271,7 +271,7 @@
</p>
</div>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-26-min.png" alt="plasmid map testing sensing plasmid" class="img-fluid " style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-26-min.png" alt="plasmid map testing sensing plasmid" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center; padding-bottom:20px;">
<b>Figure 6:</b> Sequence Aligment. Created with BioRender.com
</p>
@@ -326,7 +326,7 @@
The aim now is to test, which of the different DGCs produce the most c-di-GMP and therefore lead to the highest formation of biofilm components.
Five different testing plasmids, carrying the five different DGCs, were assembled and transformed into <i>E. coli</i> SY327: pT21Rhyz01, pT21Rhyz02, pT21Rhyz03, pT21Rhyz03, pT21Rhyz04 and pT21Rhyz05 (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">see Parts List for more details</a>).
Each of those plasmids contain an inducible Rhamnose promoter and one of the five DGC sequences.
- Additionally we performed Triparental conjugation (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments</a>) and the five plasmids were transformed into <i>P. sp.</i> IsoF using the helper strain <i>E. coli</i> SY327 pRK2013.
+ Additionally we performed Triparental conjugation (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments</a>) and the five plasmids were transformed into <i>P. sp.</i> IsoF using the helper strain <i>E. coli</i> SY327 pRK2013.
</p>
</div>
</div>
@@ -350,7 +350,7 @@
These five newly cloned plasmids pBBR pT21Rhyz01, pBBR pT21Rhyz02,pBBR pT21Rhyz03,pBBR pT21Rhyz04 and pBBR pT21Rhyz05 were then conjugated into <i>P. sp.</i> IsoF using triparental conjugation.
</p>
<div class="row mt-4 image-description">
- <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-23-dgc-ligation-pcr.webp" alt="DGC Ligation PCR" class="img-fluid" style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-23-dgc-ligation-pcr.webp" alt="DGC Ligation PCR" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center; padding-left:60; padding-right:60;">
<b>Figure 7:</b> Colony PCR revealed that the digestion ligation into the pBBR1MCS5 backbone of the transcription units containing the different DGCs was successful.
</p>
@@ -362,29 +362,29 @@
To compare the different enzymes and their mutants, we measured the c-di-GMP concentration of the five different <i>P. sp.</i> IsoF strains containing the respective testing plasmid, using the c-di-GMP assay kit from Lucerna Technologies.
</p>
<p>
- Preliminary tests were conducted to identify the optimal conditions for the assay (refer to experiments for more details).
- After adjusting the protocol based on the preliminary results, the c-di-GMP assay was performed three times (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments for details</a>).
+ Preliminary tests were conducted to identify the optimal conditions for the assay.
+ After adjusting the protocol based on the preliminary results, the c-di-GMP assay was performed three times (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for details</a>).
</p>
<p>
The overnight cultures were adjusted to an OD of 0.03, then induced by adding 125ul of 40% Rhamnose to achieve a final concentration of 1% in a 5ml tube.
This led to the expression of the enzyme.
The cultures were incubated for 5 hours and then washed with NaCl solution to eliminate background interference from the LB medium.
The absorbance of each overnight culture was measured with a spectrophotometer and adjusted to an optical density (OD) of 0.25.
- A black 96-well plate was set up according to the <a href="{{ url_for('pages', page='experiments') }}#protocol" class="hyperlink-under">c-di-GMP assay protocol</a>.
+ A black 96-well plate was set up according to the c-di-GMP assay protocol.
As negative controls, we used <i>P. sp.</i> IsoF dCas9 (contains no plasmid but dCas9 is implemented on genome), <i>P. sp.</i> IsoF pBBR1MCS (<i>P. sp.</i> IsoF containing the empty plasmid) and as a positive control we used <i>P. sp.</i> IsoF pBBR1MCS YedQ (constitutively overexpressed DGC).
Into each well, 50ul of each of the adjusted and diluted cultures, were added. Each strain was tested in triplicate (3 replicates per strain).
The plate was incubated in the dark for 14 hours.
Then the fluorescence was measured with a plate reader, with the first excitation set at 469nm and emission at 501nm, followed by a second measurement with excitation set at 482nm and emission at 505nm.
</p>
<p>
- After the c-di-GMP assay, we performed a biofilm staining assay (<a href="{{ url_for('pages', page='experiments') }}#protocol" class="hyperlink-under">see experiments for more details</a>).
+ After the c-di-GMP assay, we performed a biofilm staining assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>).
A square plate containing 50ml LB medium with agar and 1.25ml of a Congo-Red derived dye (2mg/ml) was prepared and dried.
This dye stains polysaccharides and therefore the biofilm produced by our <i>P. sp.</i> IsoF strains.
The cultures were adjusted to an OD of 1 and 10ul of each adjusted strain were plated onto the prepared plate.
The plate was incubated at 30°C for two days.
</p>
<p>
- Additionally we conducted a swimming motility assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments for more details</a>), to assess whether the introduction of a DGC would affect the bacterial motility.
+ Additionally we conducted a swimming motility assay, to assess whether the introduction of a DGC would affect the bacterial motility.
Elevated levels of c-di-GMP are associated with reduced motility, which in turn promotes biofilm formation, since a lower motility is beneficial for forming a robust biofilm<a href="#ref2">2</a>.
</p>
<section style="background-color: var(--bs-gray-100);" class="py-5">
@@ -448,7 +448,7 @@
<p>
Our mutated DGC PisoF_00565 R196A resulted in a significantly higher concentration of c-di-GMP compared the wildtype sequence of PisoF_00565. This indicates that we successfully modified the enzyme’s I-site, which usually reduces enzyme activity when c-di-GMP binds.
By altering the sequence of the DGC we prevented c-di-GMP from binding to the negative allosteric site, which effectively enhanced the enzyme’s activity. This has never been done and showed before for any DGC native to <i>P. sp.</i> IsoF.
- For further details on the results, please refer to the <a href="{{ url_for('pages', page='results') }}" class="hyperlink-under">Results page</a>.
+ For further details on the results, please see the <a href="{{ url_for('pages', page='results') }}" class="hyperlink-under">Results page</a>.
</p>
<p>
@@ -469,7 +469,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-6 col-md-6 col-sm-12 order-2 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/project/engineering/img-new-sgrna.png" alt=" CRISPRi llustration" class="img-fluid" style="width: 75%;">
+ <img src="https://static.igem.wiki/teams/5250/project/engineering/img-new-sgrna.png" alt="CRISPRi llustration" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<div class="image-model" style="text-align:center">
<p><b>Figure 13:</b> CRISPRi Illustration. Created with BioRender.com</p>
</div>
@@ -509,7 +509,6 @@
The CRISPRi system is therefore rhamnose inducible, which allows us to control the expression of the dCas9 and our knockdown.
</p>
<p>
-
The sgRNA consists of two main parts: a tracr-cr sequence and a guide sequence.
The tracr-cr sequence is 35 base pairs long and forms a hairpin structure, which is essential for the dCas9 to remain bound to the target DNA sequence and stops the DNA polymerase to function.
The sequence for this tracr-cr is: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC.
@@ -529,20 +528,21 @@
And lastly, we extended the guide sequence by an additional 12 nucleotides.
</p>
<p>
- The final sequence of the sgRNA, excluding the PAM sequence, is:
- 5’-<u>CAATGAAACCAATACACTAT</u><i>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC</i>-3’.
+ The final sequence of the sgRNA, excluding the PAM sequence, is: <br>
+ 5’-<u>CAATGAAACCAATACACTAT</u><br>
+ <i>GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC</i>-3’.
</p>
<p>
In this sequence the underlined part represents the guide RNA, while the italicized part represents the tracr-cr RNA.
</p>
</div>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/engineering/img-new.png" alt="sgRNA" class="img-fluid" style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/engineering/img-new.png" alt="sgRNA" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;"><b>Figure 14:</b> Our sgRNA to knockdown PDE PisoF_02645. Created with BioRender.com</p>
</div>
<p>
This sequence was then synthesized as a primer by Microsynth.
- Following the CRISPR interference protocol (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments detailed protocol</a>), the sgRNA was cloned into the plasmid using PCR amplification and blunt-end ligation.
+ Following the CRISPR interference protocol (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments detailed protocol</a>), the sgRNA was cloned into the plasmid using PCR amplification and blunt-end ligation.
We performed PCR amplification to insert our sgRNA into the pSCB2-sgRNA-Gm plasmid.
This plasmid already contains the tracr-crRNA sequence, which allows the tracr-crRNA part of our sgRNA to anneal directly to the template plasmid.
The guide RNA sequence, however, is not yet present on the plasmid. Since the guide RNA is physically linked to the tracr-crRNA, the DNA polymerase extends the sequence by adding nucleotides during the PCR reaction, resulting in a plasmid that includes both the guide RNA and the tracr-crRNA.
@@ -554,7 +554,7 @@
Finally, we performed a triparental conjugation to introduce p1DRhyz04 into <i>P. sp.</i> IsoF dCas9.
</p>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-8-pscb2-p1drhyz04-sgrna-1.png" alt="pscb2-p1drhyz04-sgrna" class="img-fluid" style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/engineering/picture-8-pscb2-p1drhyz04-sgrna-1.png" alt="pscb2-p1drhyz04-sgrna" class="img-fluid responsive-img-smaller" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;"><b>Figure 15: </b>Plasmid map of p1DRhyz04</p>
</div>
@@ -572,13 +572,13 @@
The plate was then incubated in the dark for one hour. Then the fluorescence was measured using a plate reader and the first measurement was taken with excitation at 469nm and emission at 501nm, the second measurement with excitation set at 482nm and emission at 505nm.
</p>
<p>
- After the c-di-GMP assay we conducted a biofilm staining assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments for more details</a>), again following the same procedure as the biofilm staining assay for our different DGCs.
+ After the c-di-GMP assay we conducted a biofilm staining assay (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>), again following the same procedure as the biofilm staining assay for our different DGCs.
The overnight culture of each strain was induced with rhamnose and adjusted to an OD of one. 10ul of each adjusted strain was plated onto the prepared dyed plate.
The plate was incubated at 30°C for two days.
The absorbance of each strain was then measured using a fluorescence microscope.
</p>
<p>
- Additionally we conducted a swimming motility assay (refer to experiments for more details), to assess whether the knockdown of a PDE would affect the bacterial motility. Elevated levels of c-di-GMP are associated with reduced motility, which in turn promotes biofilm formation, since a lower motility is beneficial for forming a robust biofilm<a href="#ref2">2</a>.
+ Additionally we conducted a swimming motility assay, to assess whether the knockdown of a PDE would affect the bacterial motility. Elevated levels of c-di-GMP are associated with reduced motility, which in turn promotes biofilm formation, since a lower motility is beneficial for forming a robust biofilm<a href="#ref2">2</a>.
</p>
</div>
<div class="row mt-4">
@@ -701,25 +701,25 @@
<hr>
<h3 style="color:black; font-size:20px;">Design and Build</h3>
<p>
- To ensure that the bacteria die when they move away from the plant roots, we incorporated a kill switch into our construct using the gyrase-inhibiting Toxin/Antitoxin system CcdB/CcdA..
+ To ensure that the bacteria die when they move away from the plant roots, we incorporated a kill switch into our construct using the gyrase-inhibiting Toxin/Antitoxin system CcdB/CcdA.
The ccdB gene encodes the toxic protein CcdB, which inhibits the DNA gyrase and therefore leads to cell death.
The ccdA gene encodes the antitoxin protein CcdA that neutralizes the toxin by forming a CcdA-CcdB complex and therefore protecting the cell<a href="#ref10">10</a>.
</p>
<p>
Our first goal was to determine the amount of CcdB required to effectively kill the cell.
- Therefore we designed three testing plasmids pT41Rhyz01, pT41Rhyz02 and pT41Rhyz03 (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">see "Parts" for more details</a>) with Golden Gate Assembly and transformed into <i>E. coli</i> SY327.
+ Therefore we designed three testing plasmids pT41Rhyz01, pT41Rhyz02 and pT41Rhyz03 (<a href="{{ url_for('pages', page='parts') }}" class="hyperlink-under">see Parts for more details</a>) with Golden Gate Assembly and transformed into <i>E. coli</i> SY327.
Each of these plasmids contains the toxin gene but with a different ribosome binding site (RBS) strength.
pT41Rhyz01 has the weakest RBS leading to little toxin production, while pT41Rhyz03 has the strongest RBS leading to high toxin production.
The expression of the toxin is controlled by an rhamnose promoter to ensure the toxin is produced only when we induce it with rhamnose.
</p>
<p>
- The first toxin test (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments for more details</a>) in <i>E. coli</i> SY327 showed that the bacteria does not get killed by the toxin, indicating that <i>E. coli</i> SY327 is resistant to CcdB.
+ The first toxin test (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>) in <i>E. coli</i> SY327 showed that the bacteria does not get killed by the toxin, indicating that <i>E. coli</i> SY327 is resistant to CcdB.
Those three plasmids were then transformed into <i>E. coli</i> DH5alpha and the same toxin test was conducted. Again, the experiment failed and the bacteria weren’t killed.
After in-depth research we found that <i>E. coli</i> SY327 as well as E. coli DH5alpha had a mutation in their gyrase and were therefore resistant to our toxin <a href="#ref6">6</a>.
</p>
<p>
We identified three suitable <i>E. coli</i> strains<a href="#ref6">6</a>: E. coli HB101, <i>E. coli</i> MC1061 and <i>E. coli</i> CSH50.
- We prepared competent cells following the protocol (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Protocol for more details</a>) and transformed our plasmids into this new strain.
+ We prepared competent cells following the protocol (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments protocol for more details</a>) and transformed our plasmids into this new strain.
</p>
<p>
Since these three testing plasmids also contain the pJUMP28-1A backbone, we assumed that they would also not replicate in <i>P. sp.</i> IsoF.
@@ -740,7 +740,7 @@
<div class="row mt-4">
<h3 style="color:black; font-size:20px;">Test</h3>
<p>
- We performed the same toxin assay 1 (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see experiments for more details</a>) for all different <i>E. coli</i> strains.
+ We performed the same toxin assay 1 (<a href="{{ url_for('pages', page='experiments') }}" class="hyperlink-under">see Experiments for more details</a>) for all different <i>E. coli</i> strains.
The toxin assay consists of an OD measurement overnight.
The overnight cultures were adjusted to an OD of 0.01 and induced with different rhamnose concentrations (0%, 1%, 1.5%).
Then they were incubated for four hours.
diff --git a/wiki/pages/entrepreneurship.html b/wiki/pages/entrepreneurship.html
index 1a227b4b383f402edcba26df6994b743fa7da194..894f7a594c918ba6a04ba6a43a9c5b41871ae69c 100644
--- a/wiki/pages/entrepreneurship.html
+++ b/wiki/pages/entrepreneurship.html
@@ -30,7 +30,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-01.webp" alt="Introduction" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-01.webp" alt="Introduction" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -52,7 +52,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-02.jpg" alt="Implementation" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-02.jpg" alt="Implementation" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -73,7 +73,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-03.jpg" alt="Hydroponic Greenhouses" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-03.jpg" alt="Hydroponic Greenhouses" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -120,7 +120,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-04.jpg" alt="Entrepreneurship" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-04.jpg" alt="Entrepreneurship" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -163,7 +163,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-05.jpg" alt="Industry Insights" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-05.jpg" alt="Industry Insights" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -231,7 +231,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-06.jpg" alt="Entrepreneurship" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/entrepreneurship/img-06.jpg" alt="Entrepreneurship" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
diff --git a/wiki/pages/experiments.html b/wiki/pages/experiments.html
index c8be545eb0816045ddf411a103a23660194c363d..f412042142ab72d5938fb87172dbe24843c7467b 100644
--- a/wiki/pages/experiments.html
+++ b/wiki/pages/experiments.html
@@ -326,18 +326,24 @@
</div>
</div>
- <div id="protocol" class="row mt-4 justify-content-center">
- <!-- Button to Show PDF in Collapsible Section -->
- <div class="col-auto">
- <button class="btn btn-custom-show" type="button" data-bs-toggle="collapse" data-bs-target="#riddles" aria-expanded="false" aria-controls="riddles">
- Show Protocol
- </button>
- </div>
- <!-- Button to Download PDF -->
- <div class="col-auto">
- <a class="btn btn-custom-download" href="https://static.igem.wiki/teams/5250/project/experiments/updated-experiments-protocols.pdf" target="_blank" download>
- Download Protocol
- </a>
+ <div class="row mt-4">
+ <div class="col-lg-12">
+ <h2>Protocol</h2>
+ <hr>
+ <div id="protocol" class="row mt-4 justify-content-center">
+ <!-- Button to Show PDF in Collapsible Section -->
+ <div class="col-auto">
+ <button class="btn btn-custom-show" type="button" data-bs-toggle="collapse" data-bs-target="#riddles" aria-expanded="false" aria-controls="riddles">
+ Show Protocol
+ </button>
+ </div>
+ <!-- Button to Download PDF -->
+ <div class="col-auto">
+ <a class="btn btn-custom-download" href="https://static.igem.wiki/teams/5250/project/experiments/updated-experiments-protocols.pdf" target="_blank" download>
+ Download Protocol
+ </a>
+ </div>
+ </div>
</div>
</div>
diff --git a/wiki/pages/home.html b/wiki/pages/home.html
index ef89e6e2cc8c995fb30327bee4ee223d864d0b51..a22530d2d9ad5c09a20512d0db77eb74eb5363c4 100644
--- a/wiki/pages/home.html
+++ b/wiki/pages/home.html
@@ -191,7 +191,9 @@
<div class="col-lg-12" style="text-align: center;">
<h2>The (Almost) Original Tale of How Our Project Idea Was Born</h2>
<hr>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/664b10eb-142f-406e-8832-5ce95e465e2c" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container" style="display: block; margin: auto;">
+ <iframe src="https://video.igem.org/videos/embed/664b10eb-142f-406e-8832-5ce95e465e2c" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
</div>
<!-- Sixth Section: References-->
diff --git a/wiki/pages/human-practices.html b/wiki/pages/human-practices.html
index 85a7e2426fe50c068c7a81f1359fdab9d3cd71fd..b8c6728a016a5681feadfd78d3967af77abe2440 100644
--- a/wiki/pages/human-practices.html
+++ b/wiki/pages/human-practices.html
@@ -18,7 +18,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-01.jpg" alt="Human Practices" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-01.jpg" alt="Human Practices" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -47,7 +47,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-02.jpg" alt="Sustainability" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-02.jpg" alt="Sustainability" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -68,7 +68,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-03.png" alt="Integrated Human Practices" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-03.png" alt="Integrated Human Practices" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -103,7 +103,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-04.jpg" alt="Education" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/description/img-04.jpg" alt="Education" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
diff --git a/wiki/pages/integrated-human-practices.html b/wiki/pages/integrated-human-practices.html
index b26391e3c78ed85265f6d183e657827f83afa1ac..e979e11c98307bc358b3fcac60c1e45ebbb7552f 100644
--- a/wiki/pages/integrated-human-practices.html
+++ b/wiki/pages/integrated-human-practices.html
@@ -16,7 +16,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/top-image.jpg" alt="Sustainability" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/top-image.jpg" alt="Sustainability" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -79,7 +79,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-01.webp" alt="Image of Dr. Zaira Heredia Ponce" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-01.webp" alt="Image of Dr. Zaira Heredia Ponce" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -102,7 +102,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-02.webp" alt="Image of Dr. Gabriella Pessi" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-02.webp" alt="Image of Dr. Gabriella Pessi" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -120,7 +120,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-03.webp" alt="Image of Dr. Aurélien Bailly" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-03.webp" alt="Image of Dr. Aurélien Bailly" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -139,7 +139,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-04.webp" alt="Image of Dr. Joëlle Schläpfer" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-04.webp" alt="Image of Dr. Joëlle Schläpfer" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -169,7 +169,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-05.webp" alt="Image of Vivienne Oggier" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-05.webp" alt="Image of Vivienne Oggier" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -212,7 +212,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-06.webp" alt="Image of Fritz Meier" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-06.webp" alt="Image of Fritz Meier" class="img-fluid small-img-small" >
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -234,7 +234,7 @@
During our interview, we realized how important consumers are to the supply chain and ultimately to agricultural practices.
We also learned that the use of microorganisms to strengthen crops is possible and important for agriculture and can be implemented in greenhouses and open fields.
</p>
- <p>Fritz Meier was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices<a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under"> Interviews page</a>.</p>
+ <p>Fritz Meier was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices <a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under">Interviews page</a>.</p>
</div>
</div>
@@ -246,7 +246,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-07.webp" alt="Image of Andreas Krättli" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-07.webp" alt="Image of Andreas Krättli" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -274,7 +274,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-08.webp" alt="Image of Dr. Mosisa Wakjira" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-08.webp" alt="Image of Dr. Mosisa Wakjira" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -294,7 +294,7 @@
In addition, his comments on current agricultural practices to prevent water loss taught us the importance of integrating our <i>P. sp. </i>IsoF into a system that is well adapted to dry conditions for a holistic approach to drought.
</p>
<p>
- Dr. Mosisa Wakjira was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices<a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under"> Interviews page</a>.
+ Dr. Mosisa Wakjira was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices <a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under">Interviews page</a>.
</p>
</div>
</div>
@@ -307,7 +307,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-09.webp" alt="Image of Rahel Emmenegger" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-09.webp" alt="Image of Rahel Emmenegger" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -332,7 +332,7 @@
This supported our decision to use xylose as a sensing molecule since most plant roots exude xylose.
</p>
<p>
- Rahel Emmenegger was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices<a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under"> Interviews page</a>.
+ Rahel Emmenegger was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices <a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under">Interviews page</a>.
</p>
</div>
</div>
@@ -345,7 +345,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-10.webp" alt="Image of Dr. Natacha Bodenhausen" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-10.webp" alt="Image of Dr. Natacha Bodenhausen" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -384,7 +384,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-11.webp" alt="Image of Dr. Anna Deplazes Zemp" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-11.webp" alt="Image of Dr. Anna Deplazes Zemp" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -410,7 +410,7 @@
It also reminded us of the importance of considering ethics, biosafety, and research independence in a project like ours.
</p>
<p>
- Dr. Anna Deplazes Zemp was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices<a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under"> Interviews page</a>.
+ Dr. Anna Deplazes Zemp was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices <a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under">Interviews page</a>.
</p>
</div>
</div>
@@ -424,7 +424,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-12.webp" alt="Image of Claudia Vaderna " class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-12.webp" alt="Image of Claudia Vaderna " class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -446,7 +446,7 @@
We were vindicated in our decision to incorporate a sensing mechanism and kill switch into our bacteria to ensure biosafety, but we learned that we would need to conduct a lot of safety testing before we could responsibly apply a product like RhyzUp.
</p>
<p>
- Claudia Vaderna was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices<a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under"> Interviews page</a>.
+ Claudia Vaderna was one of the stakeholders who agreed to a recorded interview. You can find the interview on the Human Practices <a href="{{ url_for('pages', page='interviews') }}" class="hyperlink-under">Interviews page</a>.
</p>
</div>
</div>
@@ -459,7 +459,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-fluckiger.jpeg" alt="Image of Dr. Jürg Niklaus" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-fluckiger.jpeg" alt="Image of Dr. Jürg Niklaus" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
@@ -489,7 +489,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-14.webp" alt="Image of Dr. Angela Bearth" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-14.webp" alt="Image of Dr. Angela Bearth" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p>
@@ -534,7 +534,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-15.webp" alt="Image of Reto Flückiger" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/integrated-hp/img-15.webp" alt="Image of Reto Flückiger" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p>
diff --git a/wiki/pages/interviews.html b/wiki/pages/interviews.html
index e75b71290d6f13c6701b7981641dd28f2277d35d..931c82a607122b4c5f802dbda0f31b3d01d8d157 100644
--- a/wiki/pages/interviews.html
+++ b/wiki/pages/interviews.html
@@ -19,40 +19,54 @@
<div class="row mt-4">
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Fritz Meier - Farmer and Owner of Gebrüder Meier Gemüsekulturen AG (Farming)</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/8a86e92b-65cf-4d9c-a99f-4acde86c9bbf" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/8a86e92b-65cf-4d9c-a99f-4acde86c9bbf" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Vivienne Oggier - Offices for Vegetable Cultivation and Beekeeping in St. Gallen</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/12bcb822-56f6-4fbc-a5e1-6b54b15ab759" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/12bcb822-56f6-4fbc-a5e1-6b54b15ab759" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
</div>
<div class="row mt-4">
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Dr. Mosisa Wakjira - Agrometeorology Expert</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/27a9b6bb-319f-4f0b-a047-9ec062faefc9" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/27a9b6bb-319f-4f0b-a047-9ec062faefc9" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Dr. Angela Bearth - Consumer Behavior Expert</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/7fe3d1a4-b81f-4710-8bc0-1b32960969bb" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe width="560" height="315" src="https://video.igem.org/videos/embed/7fe3d1a4-b81f-4710-8bc0-1b32960969bb" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
</div>
<div class="row mt-4">
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Dr. Anna Deplazes Zemp - Bioethics and Environmental Ethics</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/8e3cf8b0-2aef-4b5b-b24e-4d1615baf2a6" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/8e3cf8b0-2aef-4b5b-b24e-4d1615baf2a6" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Claudia Vaderna - Schweizer Allianz Gentechfrei (Swiss Alliance against Gene Technology)</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/64d94ec8-4ae7-4139-a8f6-b8757fff7c30" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/64d94ec8-4ae7-4139-a8f6-b8757fff7c30" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
</div>
<div class="row mt-4">
<div class="col-lg-6 col-md-6 col-sm-12">
<h3>Rahel Emmenegger-Manser - Schweizer Getreideproduzentenverband (Swiss Grain Producers Association)</h3>
- <iframe width="560" height="315" src="https://video.igem.org/videos/embed/0430d41e-1c87-4558-9b36-59b819fa5e3f" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ <div class="video-container">
+ <iframe src="https://video.igem.org/videos/embed/0430d41e-1c87-4558-9b36-59b819fa5e3f" frameborder="0" allow="autoplay; encrypted-media" allowfullscreen></iframe>
+ </div>
</div>
</div>
diff --git a/wiki/pages/model.html b/wiki/pages/model.html
index a5fbb16b3828716f2f9f6640d91b4b2cc8c8b27c..80beac64c8fb7ff07138a428ba21456628ad09f9 100644
--- a/wiki/pages/model.html
+++ b/wiki/pages/model.html
@@ -347,7 +347,7 @@ System“. Nature Microbiology 7, Nr. 10 (19. September 2022): 1547–57.", "lin
<div class="row mt-4">
<div class="col-lg-4 col-md-6 col-sm-12 order-2 order-md-2 image-model">
<img src="https://static.igem.wiki/teams/5250/model/img-3-1.png" alt="c-di-GMP Metabolic Pathway"
- class="img-fluid" style="width: 100%;">
+ class="img-fluid small-img-small">
<p><b>Figure 7:</b> Metabolic pathway of c-di-GMP of <i>P. putida</i> KT2440. Visualization was generated
using the Escher tool.</p>
</div>
@@ -678,7 +678,7 @@ System“. Nature Microbiology 7, Nr. 10 (19. September 2022): 1547–57.", "lin
</div>
<div class="row mt-0 image-model">
<img src="https://static.igem.wiki/teams/5250/model/3-4-kt2440-comb-cell-bm-log.png"
- alt="Impact of Cellulose Production on Biomass in Different Conditions" class="img-fluid d-block mx-auto"
+ alt="Impact of Cellulose Production on Biomass in Different Conditions" class="img-fluid d-block mx-auto responsive-img-smaller"
style="width: 50%;">
<p style="text-align:center;"><b>Figure 16:</b> The production of biofilm and biomass is highly influenced by environmental conditions. In nutrient-rich, complex environments, large quantities of both are produced, whereas in simpler media, their production is significantly reduced.</p>
</div>
diff --git a/wiki/pages/new-basic-part.html b/wiki/pages/new-basic-part.html
index e47493e3e63edeea1858c0064a02dc5a25859920..632f419a69e689a5b4fa4ab4f1c8846377b3ccfc 100644
--- a/wiki/pages/new-basic-part.html
+++ b/wiki/pages/new-basic-part.html
@@ -34,7 +34,7 @@
</p>
<div class="row mt-0 image-model">
<img src="https://static.igem.wiki/teams/5250/project/new-basic-part/image-start.png"
- alt="Sequence Alignment of WspR wt and WspR mutation R198A to our DGC IsoF wt and DGC IsoF R196A" class="img-fluid d-block mx-auto" style="width: 60%;">
+ alt="Sequence Alignment of WspR wt and WspR mutation R198A to our DGC IsoF wt and DGC IsoF R196A" class="img-fluid d-block mx-auto responsive-img">
<p style="text-align:center;"><b>Figure 1:</b> Sequence Alignment of WspR wt and WspR mutation R198A to our DGC IsoF wt and DGC IsoF R196A. <br> Created with BioRender.com</p>
</div>
</div>
diff --git a/wiki/pages/notebook.html b/wiki/pages/notebook.html
index 3d5fe4667f8e23133728b17321b703fa6d2b4135..23f9beea7dfb3c7909ab1735b61c5933902d7591 100644
--- a/wiki/pages/notebook.html
+++ b/wiki/pages/notebook.html
@@ -112,7 +112,7 @@
</p>
</div>
<div class="col-lg-6 col-md-6 col-sm-12">
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w2-min.jpg" alt="Week 8" class="img-fluid" style="width: 80%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w2-min.jpg" alt="Week 8" class="img-fluid responsive-img" style="display: block; margin: 0 auto;">
</div>
</div>
</div>
@@ -160,7 +160,7 @@
</p>
</div>
<div class="col-lg-6 col-md-6 col-sm-12">
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w4.jpg" alt="Week 4" class="img-fluid" style="width: 60%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w4.jpg" alt="Week 4" class="img-fluid responsive-img" style="display: block; margin: 0 auto;">
</div>
</div>
</div>
@@ -211,7 +211,7 @@
We conducted a preliminary toxin assay using rhamnose induced overnight cultures. We measured OD600 over a 16-hour period expecting that the toxin-induced cultures would exhibit reduced growth.
However, the rhamnose-treated cultures displayed a higher OD600, leading us to question whether the OD is a good indicator of cell death, whether the cells were using rhamnose as an extra source of energy and whether our rhamnose promoter might be the issue.
</p>
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w6-min.jpg" alt="Week 8" class="img-fluid" style="width: 25%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w6-min.jpg" alt="Week 8" class="img-fluid responsive-img-supersmall" style="display: block; margin: 0 auto;">
</div>
<!-- Week 7 -->
@@ -265,7 +265,7 @@
Since the digestion-ligation of the DGC Transcription Units failed last week, we repeated the experiment.
Extending the digestion period allowed us to successfully clone the testing plasmids with the five different DGCs into the pBBRMCS5 plasmid.
</p>
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w8.jpg" alt="Week 8" class="img-fluid" style="width: 25%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w8.jpg" alt="Week 8" class="img-fluid responsive-img-smaller" style="display: block; margin: 0 auto;">
</div>
@@ -353,7 +353,7 @@
Therefore, we inoculated MicroTom plants (<i>Solanum lycopersicum</i>) with <i>P. sp.</i> IsoF pBBR1MCS5 yedQ, a PDE overexpression (<i>P. sp.</i> IsoF pBBR PDE), our strain with the empty plasmid(<i>P. sp.</i> IsoF wt pBBR1MCS5) and LB as a negative control.
We collected data from 4 plants as a T0 measurement.
</p>
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w10.jpg" alt="Week 10" class="img-fluid" style="width: 25%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w10.jpg" alt="Week 10" class="img-fluid responsive-img-supersmall" style="display: block; margin: 0 auto;">
</div>
@@ -426,7 +426,7 @@
We collected data from the remaining plants inoculated in Week 10, which involved measuring the aerial mass and plating a dilution series of bacteria from the rhizosphere.
The dry weight of the plants was recorded the following week.
</p>
- <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w12-min.jpg" alt="Week 10" class="img-fluid" style="width: 50%; display: block; margin: 0 auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/notebook/img-w12-min.jpg" alt="Week 10" class="img-fluid responsive-img-smaller" style="display: block; margin: 0 auto;">
</div>
</div>
</div>
diff --git a/wiki/pages/results.html b/wiki/pages/results.html
index 6fb863addb106d5bcd13780d30530f02308962ea..a3b63f12bdb3102740c5c7e140b2da0743a45f3e 100644
--- a/wiki/pages/results.html
+++ b/wiki/pages/results.html
@@ -82,7 +82,7 @@
Built on these findings, we proceeded to conduct three c-di-GMP assays, focusing on the effects of PDE and Diguanylate cyclase (<a href="#section-6" class="hyperlink-under">see section “Diguanylate cyclases“</a>) activity under the identified optimal conditions.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-01-1.png" alt=" Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 1 and 2" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-01-1.png" alt=" Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 1 and 2" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b> Figure 1: Fluorescence Intensity from c-di-GMP Assay across different Strains, Experiment 1 and 2:</b> The box plot shows the fluorescence intensity measurements for various <span style="font-style: normal;">Pseudomonas sp.</span> IsoF strains in a c-di-GMP assay, representing the c-di-GMP levels in each strain.
</p>
@@ -120,7 +120,7 @@
We took pictures of the fluorescence from different cultures and processed them with ImageJ to quantify the fluorescence levels.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-02-1.png" alt="Biofilm staining assay 1 point plot" class="img-fluid " style="width: 60%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-02-1.png" alt="Biofilm staining assay 1 point plot" class="img-fluid responsive-img-smaller" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 2: Biofilm staining assay 1 point plot</b>
</p>
@@ -145,14 +145,14 @@
<i>P. sp.</i> IsoF dCas9 with the sgRNA showed higher fluorescence than the controls, but lower than <i>P. sp.</i> IsoF YedQ.
This suggests that the sgRNA inhibits the PDE PisoF_02645, leading to increased c-di-GMP levels and higher polysaccharide production.
This is also shown in the raw data, as can be seen in Table 1. The table shows the mean fluorescence of the different strains.
- The strain contains the sgRNA and therefore inhibits the PDE on its genome, has increased fluorescence signal, and thus produces more polysaccharides, compared to the negative controls but shows less signal than the positive control.
+ The strain that contains the sgRNA and therefore inhibits the PDE on its genome, has increased fluorescence signal, and thus produces more polysaccharides, compared to the negative controls but shows less signal than the positive control.
The presence of the sgRNA alone leads to an increase in polysaccharide staining but as shown in the graph, inducing the strain containing the sgRNA with rhamnose did not result in a big difference compared to the non-induced strains.
Polysaccharide production did not increase substantially when dCas9 was induced compared to when it wasn’t, suggesting that the rhamnose promoter in front of dCas9 may be leaky.
Discussions with our advisor confirmed that similar results were observed in other gene knockdown experiments.
No statistical tests could be performed as we only had one replicate per strain for this assay.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-03-1.png" alt="Table with mean fluorescence" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-03-1.png" alt="Table with mean fluorescence" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Table 1: Table with mean fluorescence</b>
</p>
@@ -174,7 +174,7 @@
The explained variance of the bacterial strain variable is 18’046.4, while the unexplained variance is 259.1, with an overall p-value of 2.062e-07.
</p>
<div class="row mt-4 image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-04-1.png" alt="Biofilm staining assay 2 point plot" class="img-fluid " style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-04-1.png" alt="Biofilm staining assay 2 point plot" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 3: Biofilm staining assay 2 point plot</b>
</p>
@@ -193,7 +193,7 @@
Figure 4 shows that the knocked down PDE shows a decreased motility when rhamnose is added, as expected. With the PDE knocked down, c-di-GMP is not degraded, increasing the potential for biofilm formation, which aligns with our expectations.
</p>
<div class="row mt-4 image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-05-1.png" alt="Figure 4: Swimming Motility Assay point plot" class="img-fluid " style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-05-1.png" alt="Figure 4: Swimming Motility Assay point plot" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 4: Swimming Motility Assay point plot</b>
</p>
@@ -233,7 +233,7 @@
To test our DGC constructs, we applied the same c-di-GMP assay as described for the PDE, with the findings illustrated in Figure 1 (shown again for clarity).
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-01-1.png" alt=" Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 1 and 2" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-01-1.png" alt=" Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 1 and 2" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b> Figure 1: Fluorescence Intensity from c-di-GMP Assay across different Strains, Experiment 1 and 2:</b> The box plot shows the fluorescence intensity measurements for various <i>P. sp.</i> IsoF strains in a c-di-GMP assay, representing the c-di-GMP levels in each strain.
</p>
@@ -274,7 +274,7 @@
<p>
Next, we compared our constructs to a control <i>P. sp.</i> IsoF dCas9 without plasmid to quantify the change in c-di-GMP production.
Several of our tested strains show a notable increase in c-di-GMP production compared to the control <i>P. sp.</i> IsoF dCas9 no plasmid, however only the mutated DGC WspR (DGC WspR R242A) showed statistical significance for it (t = 2.4238, df = 7.3234, p-value = 0.04433).
- The high variability in the DGC WspR might suggest that while the construct has a promising potential to achieve high c-di-GMP levels, further optimization are required to achieve more consistent results.
+ The high variability in the DGC WspR might suggest that while the construct has a promising potential to achieve high c-di-GMP levels, further optimization is required to achieve more consistent results.
Although our mutations of the DGC native to <i>P. sp.</i> IsoF (DGC PisoF R196A and DGC PisoF R240) did not show a significant increase in c-di-GMP levels compared to the empty plasmid, we believe that obtaining more data points could provide a clearer picture, as there appears to be a noticeable difference in c-di-GMP levels visually.
Further, when compared to <i>P. sp.</i> IsoF dCas9 empty plasmid, DGC PisoF R196A shows a significant increase (t = -2.9931, df = 5.3119, p-value = 0.02814) indicating inconsistencies in the data, since no difference between the two controls is expected.
</p>
@@ -284,7 +284,7 @@
The results of the third experiment can be seen in Figure 5.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-06-1.png" alt="Figure 5: Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 3." class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-06-1.png" alt="Figure 5: Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 3." class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b> Figure 5: Fluorescence Intensity from c-di-GMP Assay Across Different Strains, Experiment 3.</b>
</p>
@@ -308,13 +308,13 @@
<div class="row mt-4">
<h4>2.2 Biofilm staining</h4>
<p>
- Figure 3 represents the fluorescence data of the strains containing the five different DGCs (alongside the strain containing the sgRNA to knockdown PDE).
+ Figure 3 (shown again below) represents the fluorescence data of the strains containing the five different DGCs (alongside the strain containing the sgRNA to knockdown PDE).
The figure illustrates the mean fluorescence for each strain.
<i>P. sp.</i> IsoF dCas9 and <i>P. sp.</i> IsoF with an empty pBBR1MCS5 plasmid served as negative controls, while <i>P. sp.</i> IsoF YedQ once again served as a positive control.
Each strain and condition (with and without rhamnose) was measured in duplicate.
</p>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-04-1.png" alt="Figure 3: Biofilm staining assay 2 point plot" class="img-fluid " style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-04-1.png" alt="Figure 3: Biofilm staining assay 2 point plot" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 3: Biofilm staining assay 2 point plot</b>
</p>
@@ -379,18 +379,20 @@
As DGCs drive biofilm formation by producing c-di-GMP, we expect to see a shift in our DGC strains from a motile to a more sessile state in which biofilm-formation can take place.
</p>
<p>
- Figure 4 shows that the DGC WspR and the mutated form WspR R242A show the highest motility (indicated by the swimming motility diameter) when the DGC is not induced by rhamnose.
- The high motility levels suggest that these strains may be in a state with less biofilm formation.
- However, in the presence of rhamnose, their motility drastically decreases in the first assay (the effect is not as drastic in the second one).
- This indicates that when c-di-GMP is further increased due to DGC activity, motility decreases as expected, which aligns with an increased potential for biofilm formation.
- The sharp drop in motility suggests that WspR likely contributes heavily to biofilm formation when expressed.
+ Figure 4 (shown again below) shows that the DGC WspR and the mutated form WspR R242A show the highest motility (indicated by the swimming motility diameter) when the DGC is not induced by rhamnose.
</p>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-05-1.png" alt="Figure 4: Swimming Motility Assay point plot" class="img-fluid " style="width: 50%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-05-1.png" alt="Figure 4: Swimming Motility Assay point plot" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 4: Swimming Motility Assay point plot</b>
</p>
</div>
+ <p>
+ The high motility levels suggest that these strains may be in a state with less biofilm formation.
+ However, in the presence of rhamnose, their motility drastically decreases in the first assay (the effect is not as drastic in the second one).
+ This indicates that when c-di-GMP is further increased due to DGC activity, motility decreases as expected, which aligns with an increased potential for biofilm formation.
+ The sharp drop in motility suggests that WspR likely contributes heavily to biofilm formation when expressed.
+ </p>
<p>
Our mutations DGC PIsoF R240A and R196A show lower motility in both conditions, yet the rhamnose condition shows higher motility than no rhamnose condition.
This suggests that this DGC may not be as important as the WspR in decreasing the motility for example.
@@ -434,9 +436,9 @@
The initial measurements are summarized in the following graph:
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-07.png" alt="Figure 6: Initial measurements of the plants at time point 0 (30 minutes after inoculation)" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-07.png" alt="Figure 6: Initial measurements of the plants at time point 0 (30 minutes after inoculation)" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
- <b>Figure 6: Initial measurements of the plants at time point 0 (30 minutes after inoculation)</b>
+ <b>Figure 6: Initial measurements of the plants at time point 0 (30 minutes after inoculation):</b>
The net weights of the wet and dry aerial part, as well as the net weight of the rhizosphere is included in the measurements.
</p>
</div>
@@ -444,11 +446,11 @@
Figure 6 represents the time point 0 measurements that serve as a baseline for our analysis. Based on these values we can make observations about the growth that the rest of the plants in the same treatment group exhibit.
</p>
<h4>Wet weight Measurement after 14 days</h4>
- <p>We conducted the second measurement after 14 days. The remaining plants from each treatment in the dry or wet conditions respectively were processed.
+ <p>We conducted the second measurement after 14 days. The remaining plants from each treatment in the drought or wet conditions respectively were processed.
The data points are depicted in Figure 7:
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-08.png" alt="Figure 7: Net dry and wet weight of the treatment groups under normal and drought conditions." class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-08.png" alt="Figure 7: Net dry and wet weight of the treatment groups under normal and drought conditions." class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 7: Net dry and wet weight of the treatment groups under normal and drought conditions.</b>
In green is the net wet weight of all plants processed at Time point 0.
@@ -480,7 +482,7 @@
These measurements are illustrated in Figure 8 below:
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-09.png" alt="Figure 8: Net dry weight of the aerial part of the treatment groups under normal and drought conditions." class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-09.png" alt="Figure 8: Net dry weight of the aerial part of the treatment groups under normal and drought conditions." class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 8: Net dry weight of the aerial part of the treatment groups under normal and drought conditions.</b>
In green is the net dry weight of all plants processed at Time point 0.
@@ -514,7 +516,7 @@
Different amounts of soil were stuck to the roots in each sample and we adjusted the count for 1g of rhizosphere.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-10.png" alt="Figure 9: CFU/g rhizosphere from plants extracted at Timpoint 0" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-10.png" alt="Figure 9: CFU/g rhizosphere from plants extracted at Timepoint 0" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 9: CFU/g rhizosphere from plants extracted at Timpoint 0</b>
</p>
@@ -529,7 +531,7 @@
In addition, the data we obtained 14 days after inoculation represented in Figure 10 shows more relevant results.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/img-11.png" alt="Figure 10: CFU/g rhizosphere from plants extracted after 14 days of growth" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/img-11.png" alt="Figure 10: CFU/g rhizosphere from plants extracted after 14 days of growth" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 10: CFU/g rhizosphere from plants extracted after 14 days of growth</b>
</p>
@@ -571,7 +573,7 @@
<h3>Toxin Assay 1: OD Measurement</h3>
<h4>Toxin assay 1 in <i>E. coli</i> SY327 (1)</h4>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks1.png" alt="Figure 11" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks1.png" alt="Figure 11" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 11:</b>
As a negative control we used <i>E. coli</i> SY327 with an empty backbone of the same plasmids used for our toxins (pJUMP29-1D(sfGFP)).
@@ -597,7 +599,7 @@
To quantify the promoter’s activity at different rhamnose concentrations and the potentially toxic or nutritious effect of rhamnose on the cell, we performed an overnight growth assay, measuring OD600 and fluorescence at excitation 530±25 nm and emission 590±35 nm.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks2.png" alt="Figure 12" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks2.png" alt="Figure 12" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 12:</b>
Depicted is the fluorescence, and thus promoter activity at different rhamnose concentrations (1%, 1.5%, 2%, 2.5% and 3%). The values are adjusted to an OD600 of 1.00 to account for the fluorescence being stronger at higher cell numbers.
@@ -615,7 +617,7 @@
</p>
<h4>Toxin Testing in <i>E. coli</i> SY327 (2)</h4>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks3.png" alt="Figure 13" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks3.png" alt="Figure 13" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 13:</b>
Displayed are the OD600 of <i>E. coli</i> SY327 wildtype (wt) and said strain with an empty backbone (empty plas) of the same plasmids used for our toxins (pJUMP29-1D(sfGFP)) at 0%, 1% and 1.5% rhamnose.
@@ -629,7 +631,7 @@
This way, we would see the difference in growth caused by our toxin plasmid alone - expecting at least some slowed growth.
</p>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks4.png" alt="Figure 14" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks4.png" alt="Figure 14" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 14:</b>
We subtracted the growth of the empty plasmid control (pJUMP29-1D(sfGFP)) from the strains tested at the respective rhamnose concentrations (0%, 1% and 1.5%).
@@ -651,7 +653,7 @@
</p>
<h4>Toxin assay 1 in <i>E. coli</i> DH5α</h4>
<div class="image-model">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks5.png" alt="Figure 15" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks5.png" alt="Figure 15" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 15:</b>
Shown is the OD600 of <i>E. coli</i> DH5α with the toxin strengths and a control at respective rhamnose concentrations (0%, 1% and 1.5%).
@@ -669,7 +671,7 @@
</p>
<h4>Toxin assay 1 in <i>E. coli</i> HB101, <i>E. coli</i> MC1061 and <i>E. coli</i> CSH50</h4>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks6.png" alt="Figure 16" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks6.png" alt="Figure 16" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 16:</b>
Shown is the OD600 of <i>E. coli</i> HB101 with the toxin strengths and a control at respective rhamnose concentrations (0%, 1% and 1.5%). As a control (GFP plas) we used a plasmid consisting of the same backbone as our toxins but with GFP, to have a comparable metabolic strain of the toxin, but without its toxic effect (p03Rhyz11).
@@ -679,7 +681,7 @@
</p>
</div>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks7.png" alt="Figure 17" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks7.png" alt="Figure 17" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 17:</b>
We measured the OD600 of <i>E. coli</i> MC1061 with the toxin strengths and a control at respective rhamnose concentrations (0%, 1% and 1.5%).
@@ -689,7 +691,7 @@
</p>
</div>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks8.png" alt="Figure 18" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks8.png" alt="Figure 18" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 18:</b>
Shown is the OD600 of <i>E. coli</i> CSH50 with the toxin strengths and a control at respective rhamnose concentrations (0%, 1% and 1.5%).
@@ -706,7 +708,7 @@
</p>
<h4>Toxin Testing in <i>P. sp.</i> IsoF</h4>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/ks9.png" alt="Figure 19" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/ks9.png" alt="Figure 19" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 19:</b>
Shown is the OD600 of <span style="font-style: normal;">P. sp.</span> IsoF with the different toxin strengths and a control at respective rhamnose concentrations (0%, 1% and 1.5%).
@@ -755,7 +757,7 @@
The results are summarized in the following histogram:
</p>
<div class="image-description">
- <img src="https://static.igem.wiki/teams/5250/project/results/copy-of-graph-toxin-assay-2.webp" alt="Figure 21" class="img-fluid " style="width: 75%; display: block; margin-left: auto; margin-right: auto;">
+ <img src="https://static.igem.wiki/teams/5250/project/results/copy-of-graph-toxin-assay-2.webp" alt="Figure 21" class="img-fluid responsive-img" style="display: block; margin-left: auto; margin-right: auto;">
<p style="text-align:center;">
<b>Figure 21:</b>
CFU count of the <span style="font-style: normal;">E. coli.</span> CSH50 strain and <span style="font-style: normal;">P. sp.</span> IsoF strain containing the toxin plasmid against a control strain of both bacterial species containing an empty plasmid.
diff --git a/wiki/pages/safety.html b/wiki/pages/safety.html
index ca077b6640210af9929fc7bcd7e3ff879ea6862a..3579bd5836e396dbe8805c3b4f86d8efc27eab9d 100644
--- a/wiki/pages/safety.html
+++ b/wiki/pages/safety.html
@@ -74,7 +74,7 @@
<div class="col-lg-4 col-md-6 col-sm-12 order-2 order-md-2">
<div class="image-model">
<img src="https://static.igem.wiki/teams/5250/project/safety/s-1-min.jpg" alt="Security fence at Swiss Agroscope “Protected Site" class="img-fluid d-block mx-auto" style="width: 100%;">
- <p>Security fence at Swiss Agroscope “Protected Site†GMO testing facility in Reckenholz</p>
+ <p> Image 1: Security fence at Swiss Agroscope “Protected Site†GMO testing facility in Reckenholz</p>
</div>
</div>
</div>
@@ -107,7 +107,7 @@
<div class="image-model">
<img src="https://static.igem.wiki/teams/5250/project/safety/s-2-min.jpg" alt="Mattia working under the laminar flow hood adhering to BSL2 regulations" class="img-fluid d-block mx-auto" style="width: 100%;">
<p>
- Mattia working under the laminar flow hood adhering to BSL2 regulations
+ Image 2: Mattia working under the laminar flow hood adhering to BSL2 regulations
</p>
</div>
</div>
@@ -177,7 +177,7 @@
<div class="image-description">
<img src="https://static.igem.wiki/teams/5250/project/safety/s-3-min.jpg" alt="Discussion on the topic “designer babies†at our lab workshop for highschool students" class="img-fluid d-block mx-auto responsive-img-smaller">
<p style="text-align:center">
- Discussion on the topic “designer babies†at our lab workshop for highschool students
+ Image 3: Discussion on the topic “designer babies†at our lab workshop for highschool students
</p>
</div>
<p>
diff --git a/wiki/pages/sustainable.html b/wiki/pages/sustainable.html
index 30b6516f3120bbf06c5d50a53aceae3897066690..5c3e9f23b779b575022d492a9bf4d016a518eb18 100644
--- a/wiki/pages/sustainable.html
+++ b/wiki/pages/sustainable.html
@@ -86,7 +86,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2 image-model">
- <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-02.webp" alt="Goal 2" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-02.webp" alt="Goal 2" class="img-fluid small-img-small">
<p>
<b>Figure 2:</b> <a href="https://www.un.org/sustainabledevelopment/news/communications-material/" class="hyperlink-under">UN. Communication Materials. Sustainable Development Goals</a>.
</p>
@@ -294,7 +294,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-03.webp" alt="Goal 3" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-03.webp" alt="Goal 3" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p style="font-size: 28px; color:var(--dark-blue); font-weight:bold;">54</p>
@@ -377,7 +377,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-06.webp" alt="Goal 6" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-06.webp" alt="Goal 6" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
<p style="font-size: 28px; color:var(--dark-blue); font-weight:bold;">974.14%</p>
@@ -465,7 +465,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-1">
- <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-13.webp" alt="Goal 13" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-13.webp" alt="Goal 13" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-2">
<p style="font-size: 28px; color:var(--dark-blue); font-weight:bold;">1/3</p>
@@ -522,7 +522,7 @@
</div>
<div class="row mt-0">
<div class="col-lg-4 col-md-6 col-sm-12 order-1 order-md-2">
- <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-15.webp" alt="Goal 15" class="img-fluid" style="width: 100%;">
+ <img src="https://static.igem.wiki/teams/5250/human-practices/sustainability/goal-15.webp" alt="Goal 15" class="img-fluid small-img-small">
</div>
<div class="col-lg-8 col-md-6 col-sm-12 order-2 order-md-1">
diff --git a/wiki/pages/team.html b/wiki/pages/team.html
index 0ee111c211f5056355fc03bb4b3b3250788a6ca5..0373fa9475d5c14c0c494165093e1a5852afb4ac 100644
--- a/wiki/pages/team.html
+++ b/wiki/pages/team.html
@@ -24,18 +24,21 @@
<div class="team-section" id="team-container">
<h2>Team Members</h2>
<hr>
+ <h4>Click on the cards to discover more about the team members.</h4>
<div class="team-row"></div>
</div>
<div class="team-section" id="instructors-container">
<h2>Instructors</h2>
<hr>
+ <h4>Click on the cards discover more about the instructors.</h4>
<div class="team-row"></div>
</div>
<div class="team-section" id="advisors-container">
<h2>Advisors</h2>
<hr>
+ <h4>Click on the cards to discover more about the advisors.</h4>
<div class="team-row"></div>
</div>