diff --git a/src/components/engineering/EngineeringContent.jsx b/src/components/engineering/EngineeringContent.jsx
index 36dac8a15a3a1e0bb63a27c1c0c885ab55a6db05..8107ef6cd1e7ba8c753d244d06d44300a9a20ca2 100644
--- a/src/components/engineering/EngineeringContent.jsx
+++ b/src/components/engineering/EngineeringContent.jsx
@@ -2,8 +2,8 @@ import { useEffect, useState } from "react";
import { folderColors, outlinedDiv } from "../../constants/colors";
import DBTLCycle from "./Cycle";
-const EngineeringContent = ({ softwareContent, cloningContent, liquidPhaseContent, solidPhaseContent
- // bioreactorContent, micropumpContent, microchipContent
+const EngineeringContent = ({ softwareContent, cloningContent, liquidPhaseContent, solidPhaseContent, microchipContent
+ // bioreactorContent, micropumpContent,
}) => {
@@ -24,10 +24,10 @@ const EngineeringContent = ({ softwareContent, cloningContent, liquidPhaseConten
// title: "Bioreactor",
// dbtls: bioreactorContent
// },
- // {
- // title: "Microfluidic Chip",
- // dbtls: microchipContent
- // },
+ {
+ title: "Microfluidic Chip",
+ dbtls: microchipContent
+ },
// {
// title: "Microfluidic Pump",
// dbtls: micropumpContent
diff --git a/src/components/hardware/Gallery.jsx b/src/components/hardware/Gallery.jsx
index ffbcdb7859693886632aeaa5f55749d18719757a..597660c6ee6eab6a16ed76bf89321c09ad20b632 100644
--- a/src/components/hardware/Gallery.jsx
+++ b/src/components/hardware/Gallery.jsx
@@ -1,37 +1,69 @@
import { useState } from 'react';
-import './Gallery.css';
+import './Gallery.css';
const Gallery = () => {
- const [selectedImage, setSelectedImage] = useState(null);
-
- const hardware = [
- {
- name: "Bioreactor",
- image: "https://picsum.photos/id/1018/300/200",
- description: "lore ipsum",
- hyperlink: "/ubc-vancouver/hardware/bioreactor"
- },
- {
- name: "Microfluidic Pump",
- image: "https://picsum.photos/id/1019/300/200",
- description: "pump ipsum",
- hyperlink: "/ubc-vancouver/hardware/microfluidic-pump"
- },
- {
- name: "Multiphase Microfluidic Chips",
- image: "https://picsum.photos/id/1020/300/200",
- description: "chip ipsum",
- hyperlink: "/ubc-vancouver/hardware/microfluidic-chip"
- }
- ];
-
- const openPopup = (item) => {
- setSelectedImage(item);
- };
-
- const closePopup = () => {
- setSelectedImage(null);
- };
+ const [selectedImage, setSelectedImage] = useState(null);
+
+ const hardware = [
+ {
+ name: "Bioreactor",
+ image: "https://static.igem.wiki/teams/5228/bio.png",
+ description: `Our bioreactor project showcases a commitment to sustainable and accessible biomanufacturing through our iterative design-build-test-learn (DBTL) cycles which focus on integrated human practices (iHP) feedback. We developed four distinct bioreactor iterations, each building upon the previous version based on user feedback and testing results.
+
+Mark 1, our initial prototype, served as a proof-of-concept, establishing basic functionalities like aeration and agitation using readily available, affordable lab supplies and a 2L vessel. Initial iHP feedback immediately highlighted the impracticality of the large vessel size for many lab settings, emphasizing the need for a more compact design. This feedback directly influenced the development of Mark 2, which featured a significantly smaller vessel and introduced automation with a peristaltic pump for fluid handling and a temperature sensor for basic monitoring. We also prioritized simplifying the design and using readily available components to maintain affordability.
+
+Testing of Mark 2, combined with further iHP feedback, revealed the need for real-time monitoring of cell growth. Users expressed a desire for more data-driven insights to optimize culture conditions. This prompted the addition of an optical density (OD) sensor in Mark 3, housed within a custom-designed 3D-printed enclosure to ensure accurate measurements. Additionally, a user interface keypad was added to provide more control over the bioreactor's functions, directly addressing user requests for easier interaction. The reduction in plastic usage through the smaller vessel size and the potential for recycling 3D printed components further aligned with our sustainability goals.
+
+iHP feedback on Mark 3 highlighted two key areas for improvement: the need for more intuitive control mechanisms and the desire for remote access and monitoring capabilities. Users found the keypad interface cumbersome and expressed interest in controlling the bioreactor remotely. This feedback directly shaped the design of Mark 4, which replaced the keypad with a joystick for more precise and user-friendly control. An LCD screen was added to provide clear visual feedback of real-time data, enhancing monitoring capabilities. Finally, an ESP8266 Wi-Fi module was integrated, enabling remote control and monitoring via a network connection, a feature highly desired by potential users.
+
+Throughout this DBTL cycle, iHP played a crucial role, not only in gathering user feedback but also in considering the broader societal and ethical implications of our work. By prioritizing user needs, accessibility, and sustainability, while actively minimizing resource consumption and promoting recyclability, our bioreactors offer a more responsible and environmentally conscious approach to biological experimentation and biomanufacturing all while keeping bioreactors affordable and available for all.`,
+ hyperlink: "/ubc-vancouver/hardware/bioreactor"
+ },
+ {
+ name: "Microfluidic Pump",
+ image: "https://static.igem.wiki/teams/5228/pump.png",
+ description: `Our microfluidic platform is designed with sustainability and scalability at its core, developed through an iterative DBTL (Design-Build-Test-Learn) cycle, and directly informed by extensive iHP (Integrated Human Practices) feedback. Key industry stakeholders, including experts in biomanufacturing, provided valuable insights that guided our design choices, particularly in enhancing the platform’s efficiency for large-scale DNA synthesis. These interactions underscored the need for a sustainable, scalable system that minimizes resource consumption without compromising throughput.
+
+The platform employs a diverse set of passive mixing strategies, such as the "Herringbone" Helix Flow, Cantor Baffles, and "Criss-Cross" Split and Recombination chips, which were selected based on their ability to enhance chaotic mixing while minimizing reagent use. This reduces both environmental impact and operational costs, directly aligning with modern biomanufacturing goals. Each chip is optimized for high-throughput applications, ensuring the system can scale up to meet industrial needs while maintaining precision in DNA synthesis.
+
+In terms of sustainability, our microfluidic platform significantly reduces reagent waste by promoting efficient mixing at low energy inputs. Furthermore, our collaboration with experts during iHP feedback sessions reinforced the importance of using environmentally friendly materials and processes, such as laser ablation for chip fabrication, to further reduce the platform’s carbon footprint. These sustainable design features make our platform not only highly efficient but also adaptable to the needs of biomanufacturing industries looking for greener alternatives.`,
+ hyperlink: "/ubc-vancouver/hardware/microfluidic-pump"
+ },
+ {
+ name: "Multiphase Microfluidic Chips",
+ image: "https://static.igem.wiki/teams/5228/chip.png",
+ description: `This microfluidic pump represents a crucial component for our microfluidic chips, offering precise fluid control at the microscale while addressing critical sustainability challenges. By leveraging Design-Build-Test-Learn (DBTL) cycles and integrating with intensified bioprocessing hardware (iHP), this pump enables efficient and environmentally conscious production of biopharmaceuticals, biomaterials, and other valuable bioproducts.
+
+The microfluidic pump employs a peristaltic design, utilizing sequentially actuated chambers to propel fluids through microfluidic channels. This gentle pumping mechanism minimizes shear stress, crucial for maintaining the viability and functionality of sensitive biological materials like cells and proteins. Fabrication relies on biocompatible materials like PDMS, ensuring compatibility with biological systems. Precise control over flow rate and minimal backflow are achieved through carefully tuned pneumatic actuation, enabling accurate delivery of reagents and media within microfluidic devices.
+
+This microfluidic pump offers significant advantages for biomanufacturing applications:
+
+- **Improved process control:**Â Precise fluid manipulation enables optimized cell culture conditions, leading to higher yields and product quality. Nutrient delivery, waste removal, and introduction of stimuli can be precisely controlled, enhancing bioprocess efficiency.
+- **Miniaturization and automation:**Â Integration into automated microfluidic platforms facilitates high-throughput screening and process optimization, accelerating bioprocess development. Smaller reaction volumes translate to reduced reagent consumption and waste generation.
+- **Continuous processing:**Â The pump enables continuous flow operation, which can significantly enhance productivity compared to traditional batch processes. This allows for steady-state operation, optimizing cell growth and product formation.
+- **Handling of shear-sensitive materials:**Â The gentle peristaltic pumping action minimizes shear stress, making it ideal for handling delicate biological materials such as cells, proteins, and DNA.
+
+This pump contributes to sustainable biomanufacturing in several ways:
+
+- **Reduced resource consumption:**Â Miniaturization significantly decreases the volumes of reagents, media, and other resources required, minimizing both material costs and waste generation.
+- **Lower energy footprint:**Â Compared to traditional large-scale bioreactors, microfluidic systems require significantly less energy for operation, contributing to a lower carbon footprint.
+- **Reduced waste generation:**Â Smaller reaction volumes and continuous processing minimize waste generation, reducing the environmental burden associated with biomanufacturing.
+- **Potential for decentralized manufacturing:**Â Portable and modular microfluidic systems, enabled by this pump, could facilitate decentralized biomanufacturing, reducing transportation costs and emissions.
+
+The development of this microfluidic pump follows the DBTL cycle, allowing for iterative improvements and optimized performance. Experimental data on flow rate, backflow, and particle tracking are used to refine computational models and inform design modifications. This iterative process ensures that the pump meets the specific requirements of different biomanufacturing applications.
+
+Its compact footprint and precise fluid control make it ideal for integration into iHP platforms, enabling high-throughput screening, process optimization, and continuous bioprocessing at a microscale. This integration contributes to the development of more efficient and sustainable biomanufacturing processes.`,
+ hyperlink: "/ubc-vancouver/hardware/microfluidic-chip"
+ }
+ ];
+
+ const openPopup = (item) => {
+ setSelectedImage(item);
+ };
+
+ const closePopup = () => {
+ setSelectedImage(null);
+ };
return (
<div>
@@ -42,11 +74,11 @@ const Gallery = () => {
className="gallery-item"
onClick={() => openPopup(h)}
onMouseEnter={(e) => {
- e.currentTarget.querySelector('.overlay-text').style.opacity = 1;
- e.currentTarget.querySelector('img').style.filter = 'brightness(0.85)';
+ e.currentTarget.querySelector('.overlay-text').style.opacity = 1;
+ e.currentTarget.querySelector('img').style.filter = 'brightness(0.85)';
}}
onMouseLeave={(e) => {
- e.currentTarget.querySelector('.overlay-text').style.opacity = 0;
+ e.currentTarget.querySelector('.overlay-text').style.opacity = 0;
e.currentTarget.querySelector('img').style.filter = 'brightness(1)';
}}
>
@@ -63,7 +95,7 @@ const Gallery = () => {
{selectedImage && (
<div className="popup-overlay">
<div className="popup-content">
- <button
+ <button
onClick={closePopup}
className="close-button"
>
@@ -71,8 +103,8 @@ const Gallery = () => {
</button>
<h2 className="popup-title">{selectedImage.name}</h2>
<p className="popup-description">{selectedImage.description}</p>
- <a
- href={selectedImage.hyperlink}
+ <a
+ href={selectedImage.hyperlink}
className="learn-more-button"
>
Learn More
diff --git a/src/components/hardware/Panel.css b/src/components/hardware/Panel.css
index fc43f006773b6aa1f4cc8bbd0caee71d3cc745b3..629cac5c8f08dfcb5847435cda41cfff1576d8a5 100644
--- a/src/components/hardware/Panel.css
+++ b/src/components/hardware/Panel.css
@@ -1,12 +1,11 @@
.panel-container {
display: flex;
+ flex-direction: column;
justify-content: space-between;
gap: 20px;
}
.panel-box {
- width: 600px;
- height: 300px;
border: 5px solid grey;
padding: 20px;
border-radius: 25px;
diff --git a/src/components/hardware/Panel.jsx b/src/components/hardware/Panel.jsx
index 891ce669fe3d2368c6de81c9d9c3a653e4da37fb..9630e3cc4b56941432a0fd1574b3b4a19f302283 100644
--- a/src/components/hardware/Panel.jsx
+++ b/src/components/hardware/Panel.jsx
@@ -2,37 +2,42 @@ import React from 'react';
import './Panel.css';
const Panel = () => {
- const panelData = [
- {
- title: 'Creating Technologies for Scalable Biomanufacturing',
- description:'lalalalallalalalalalalallalalalalalall alalalalalallalalalalalalallalalalalalalal good job guys',
- },
- {
- title: 'Creating Platforms for Sustainable Research',
- description: 'okay good job guys yayyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy',
- },
- ];
+ const panelData = [
+ {
+ title: 'Creating Technologies for Scalable Biomanufacturing',
+ description: `Our hardware team focused on designing and developing scalable technologies that support efficient and high-throughput biomanufacturing. Central to our approach was creating interconnected systems that could accelerate the production of biological materials while minimizing resource use. Our solutions were designed to be adaptable for different scales of production, from laboratory settings to industrial biomanufacturing. We also prioritized automation and precision, ensuring that each design could be integrated seamlessly into modern biomanufacturing workflows.
+
+ Through our iterative DBTL (Design-Build-Test-Learn) cycle, we pursued three primary projects: the bioreactor, the microfluidic pump, and the multiphase microfluidic system. Each of these projects was guided by our goal of reducing the environmental impact of biological manufacturing while increasing the efficiency and scalability of the processes involved.`,
+ },
+ {
+ title: 'Creating Platforms for Sustainable Research',
+ description: `Alongside our efforts in biomanufacturing, we recognized the importance of designing hardware that aligns with sustainability goals. As part of our iHP (Integrated Human Practices) work, we consulted with stakeholders in academia and industry to better understand how our hardware could contribute to more environmentally conscious research. Our focus on sustainability informed design choices that minimized material waste, optimized energy use, and utilized low-impact fabrication methods like laser ablation.
+
+ By integrating principles of sustainability into each of our projects, we aimed to set new standards for environmentally responsible research platforms. Our hardware not only improves the efficiency of scientific workflows but also reduces the overall environmental footprint, making it suitable for long-term use in both academic research and industrial applications.`,
+ },
+ ];
- return (
- <div className="panel-container">
- {panelData && Array.isArray(panelData) && panelData.length > 0 ? (
- panelData.map((panel, index) => (
- <div key={index} className="panel-box">
- <div className="panel-inner">
- <div className="panel-front">
- <h2>{panel.title}</h2>
+ return (
+ <div className="panel-container">
+ <p>Based on these guiding principles, our team pursued three interconnected projects:</p>
+ {panelData && Array.isArray(panelData) && panelData.length > 0 ? (
+ panelData.map((panel, index) => (
+ <div key={index} className="panel-box">
+ <div className="panel-inner">
+ <div className="panel-front">
+ <h2>{panel.title}</h2>
+ </div>
+ <div className="panel-back">
+ <p>{panel.description}</p>
+ </div>
+ </div>
+ </div>
+ ))
+ ) : (
+ <p>No panels available</p>
+ )}
</div>
- <div className="panel-back">
- <p>{panel.description}</p>
- </div>
- </div>
- </div>
- ))
- ) : (
- <p>No panels available</p>
- )}
- </div>
- );
+ );
};
export default Panel;
diff --git a/src/pages/engineering.astro b/src/pages/engineering.astro
index da4b62a8287e1c99b4d4ed106696d1c5b68fdbbb..710da8e41de9b41f433d7f37983edfb400d94f55 100644
--- a/src/pages/engineering.astro
+++ b/src/pages/engineering.astro
@@ -5,7 +5,7 @@ const liquidphase = await Astro.glob("./engineering/liquidphase/*.md");
const solidphase = await Astro.glob("./engineering/sps/*.md");
const cloning = await Astro.glob("./engineering/cloning/*.md");
// const bioreactor = await Astro.glob("./engineering/bioreactor/*.md");
-// const microchip = await Astro.glob("./engineering/microchip/*.md");
+const microchip = await Astro.glob("./engineering/microchip/*.md");
// const micropump = await Astro.glob("./engineering/micropump/*.md");
const software = await Astro.glob("./engineering/software/*.md");
@@ -57,7 +57,6 @@ function map_groupby(dbtls) {
// bioreactorContent={map_groupby(bioreactor)}
// micropumpContent={map_groupby(micropump)}
-// microchipContent={map_groupby(microchip)}
---
<PaddedLayout title="Engineering">
@@ -66,6 +65,7 @@ function map_groupby(dbtls) {
cloningContent={map_groupby(cloning)}
liquidPhaseContent={map_groupby(liquidphase)}
solidPhaseContent={map_groupby(solidphase)}
+ microchipContent={map_groupby(microchip)}
client:load
/>
</PaddedLayout>
diff --git a/src/pages/engineering/bioreactor/dbtl1-build.md b/src/pages/engineering/bioreactor/dbtl1-build.md
index 7e33cd35327f166436a09f02b8a14c397c23b324..2728156f2a6683f720884a9b97a517f2838761b4 100644
--- a/src/pages/engineering/bioreactor/dbtl1-build.md
+++ b/src/pages/engineering/bioreactor/dbtl1-build.md
@@ -3,5 +3,5 @@ layout: ../../../layouts/PaddedLayout.astro
date: 2024-04-01
end: 2024-07-20
phase: build
-dbtl: 1
+dbtl: 2
---
\ No newline at end of file
diff --git a/src/pages/engineering/bioreactor/dbtl2-build.md b/src/pages/engineering/bioreactor/dbtl2-build.md
new file mode 100644
index 0000000000000000000000000000000000000000..7e33cd35327f166436a09f02b8a14c397c23b324
--- /dev/null
+++ b/src/pages/engineering/bioreactor/dbtl2-build.md
@@ -0,0 +1,7 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: build
+dbtl: 1
+---
\ No newline at end of file
diff --git a/src/pages/engineering/bioreactor/dbtl2-design.md b/src/pages/engineering/bioreactor/dbtl2-design.md
new file mode 100644
index 0000000000000000000000000000000000000000..561ec2fd35ea47ca5629869be487b771c8c9ed0f
--- /dev/null
+++ b/src/pages/engineering/bioreactor/dbtl2-design.md
@@ -0,0 +1,7 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: design
+dbtl: 2
+---
\ No newline at end of file
diff --git a/src/pages/engineering/bioreactor/dbtl2-learn.md b/src/pages/engineering/bioreactor/dbtl2-learn.md
new file mode 100644
index 0000000000000000000000000000000000000000..ab624fde325a37649298084438bc6f2a690dbcf1
--- /dev/null
+++ b/src/pages/engineering/bioreactor/dbtl2-learn.md
@@ -0,0 +1,7 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: learn
+dbtl: 2
+---
\ No newline at end of file
diff --git a/src/pages/engineering/bioreactor/dbtl2-test.md b/src/pages/engineering/bioreactor/dbtl2-test.md
new file mode 100644
index 0000000000000000000000000000000000000000..7fcb414f8bf94301aeb8ca6c3c81db110788d6f2
--- /dev/null
+++ b/src/pages/engineering/bioreactor/dbtl2-test.md
@@ -0,0 +1,7 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: test
+dbtl: 2
+---
\ No newline at end of file
diff --git a/src/pages/engineering/microchip/dbtl1-learn.md b/src/pages/engineering/microchip/dbtl1-learn.md
index b3a5c0b6f4bd83e71df6a25b0a0cc937695472da..1590dc5723530fd0308f82fd5cde41f42b18a7bc 100644
--- a/src/pages/engineering/microchip/dbtl1-learn.md
+++ b/src/pages/engineering/microchip/dbtl1-learn.md
@@ -4,4 +4,9 @@ date: 2024-04-01
end: 2024-07-20
phase: learn
dbtl: 1
----
\ No newline at end of file
+---
+
+
+The recovery of the fluorescent oligonucleotide was poor. This was evidenced by the faint band signal intensity in the DNA gel, suggesting that the amount recovered was lower than the Typhoon biomolecular imager’s detection limit.
+Of the faint bands observed, the evidence of primer elongation by ThTdT in LPS was inconclusive. Both research questions require further investigation in the next cycle.
+
diff --git a/src/pages/engineering/microchip/dbtl2-build.md b/src/pages/engineering/microchip/dbtl2-build.md
new file mode 100644
index 0000000000000000000000000000000000000000..5acabb3b2931d387525f5536128fc9e062e754aa
--- /dev/null
+++ b/src/pages/engineering/microchip/dbtl2-build.md
@@ -0,0 +1,15 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: build
+dbtl: 2
+---
+
+A two part experiment was proposed to study the effect of non-specific binding and reaction manifolds. In part 1, the effect (with vs. without use) of the microfluidic chip was studied, with the following experimental plan:
+
+
+
+Figure 27. Experimental plan to test the effect of non-specific binding of primer P2 /56FAM/AGCCTGTTGTGAGCCTCCTAAC by blocking the microfluidic chip with plasmid pET-28b.
+
+In anticipation for this test, the chip was blocked by plasmid pET-28b prior to microfluidic LPS
\ No newline at end of file
diff --git a/src/pages/engineering/microchip/dbtl2-design.md b/src/pages/engineering/microchip/dbtl2-design.md
new file mode 100644
index 0000000000000000000000000000000000000000..f87c96e52ccd8f4300cf92e615ed55a1a513a33a
--- /dev/null
+++ b/src/pages/engineering/microchip/dbtl2-design.md
@@ -0,0 +1,10 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: design
+dbtl: 2
+---
+
+To address the non-specific binding hypothesis, and experiment with a comparator (control) and intervention arm is devised. The intervention, using plasmids as blocking agents, is inspired by Enzyme-Linked ImmunoSorbent Assay (ELISA). In this assay, analytes were absorbed onto a solid support non-covalent. To ensure specificity, a relative low cost protein was sacrificially applied to block the surfaces that were not supposed to react. Common examples include fetal bovine serum (FBS), bovine serum albumin (BSA), and fat-free milk power. While it would be easy to use common nucleic acids carriers, such as tRNA and salmon sperm DNA, for the purpose of blocking, the presence of free 3’-ends will compete resources over nucleotides during the elongation reaction. Therefore, plasmids were chosen since they are DNA will no free 3’-termini.
+
diff --git a/src/pages/engineering/microchip/dbtl2-learn.md b/src/pages/engineering/microchip/dbtl2-learn.md
new file mode 100644
index 0000000000000000000000000000000000000000..3d59405e629ee6c358bf0232ddd97361fb69e8b3
--- /dev/null
+++ b/src/pages/engineering/microchip/dbtl2-learn.md
@@ -0,0 +1,15 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: learn
+dbtl: 2
+---
+
+
+Figure 29. LPS using ThTdT with dTTP and primer P2. Reaction manifolds: - not used; T thermocycler; M: microfluidic chip.
+
+We learned that blocking the microfluidic chip with plasmids appears successful compared with the unblocked results in [2024.09.29 - Microfluidic Chip LPS Experiments](/ubc-vancouver/notebook#2024-09-29-microfluidicchipexp).
+
+
+Regretfully, ThTdT activity was not observed across all reaction manifolds. The efficacy of ThTdT in microfluidic chips remains inconclusive in this entry, and warrants future studies.
\ No newline at end of file
diff --git a/src/pages/engineering/microchip/dbtl2-test.md b/src/pages/engineering/microchip/dbtl2-test.md
new file mode 100644
index 0000000000000000000000000000000000000000..765b8d49d9744985bc9ffcf98984dbaf48ecbeab
--- /dev/null
+++ b/src/pages/engineering/microchip/dbtl2-test.md
@@ -0,0 +1,13 @@
+---
+layout: ../../../layouts/PaddedLayout.astro
+date: 2024-04-01
+end: 2024-07-20
+phase: test
+dbtl: 2
+---
+
+The following experimental plan tested the efficacy of LPS on the chip, such that a three-arm study is devised. The negative control was no manipulation (stored over ice, expecting no elongation activity); the positive control was 37ºC heating in a thermocycler; and the experimental intervention was 37ºC heating in a microfluidic chip.
+
+
+
+Figure 28. Experimental plan to study the effect of reaction manifold (thermocycler, no manipulation, and microfluidic chip) on ThTdT 3’-elongation activity with Primer P2 /56FAM/AGCCTGTTGTGAGCCTCCTAAC.
diff --git a/src/pages/engineering/software/dbtl2-learn.md b/src/pages/engineering/software/dbtl2-learn.md
index 97b254ef39ce941f245f7ef7ebdb723de8046879..9a9f097a4ea39c43b76dd7ca76d83aff9eda62be 100644
--- a/src/pages/engineering/software/dbtl2-learn.md
+++ b/src/pages/engineering/software/dbtl2-learn.md
@@ -6,4 +6,4 @@ phase: learn
dbtl: 2
---
-We learned that preventing deletion or insertion errors in DNA was challenging. After discussing with Tony Liu Dr. Condon and the lab, we decided to take advantage of the diversity present in biology and resolve deletions simply by filtering out strands that are the correct length. Unfortunately, this strategy is not scaleable, and more robust error correction methods will need to be explored. Additionally, we did not have the opportunity to decode sequences from the wet lab, so many of our assumptions, results, and hypotheses must be experimentally validated.
\ No newline at end of file
+We learned that preventing deletion or insertion errors in DNA was challenging. After discussing with Tony Liu, Dr. Condon and her lab, we decided to take advantage of the diversity present in biology and resolve deletions simply by filtering out strands that are the correct length. Unfortunately, this strategy is not scaleable, and more robust error correction methods will need to be explored. Additionally, we did not have the opportunity to decode sequences from the wet lab, so many of our assumptions, results, and hypotheses must be experimentally validated.
\ No newline at end of file
diff --git a/src/pages/hardware/index.astro b/src/pages/hardware/index.astro
index a2c21ec7e8d594d13dd62140f8b2c64123d34f46..fbbc444be651ed476cd4a978bb908281082d8868 100644
--- a/src/pages/hardware/index.astro
+++ b/src/pages/hardware/index.astro
@@ -8,7 +8,8 @@ import PaddedLayout from "../../layouts/PaddedLayout.astro";
<div style="margin-top: 50px; margin-bottom: 50px;"> {/* Fixed space between titles */}
<h1 style="font-weight: bold;">Our Goals with Hardware</h1>
- <p>Some crap here </p>
+ <p>Our primary goal with hardware development is to create innovative, sustainable, and scalable technologies that can advance both research and industrial applications in synthetic biology. By focusing on modular designs and efficient resource use, we aim to enable high-throughput biomanufacturing while reducing the environmental footprint of biological processes. Each hardware project, from our bioreactor to the microfluidic pump and multiphase microfluidic system, is designed to integrate seamlessly into existing workflows, providing precise control over biological experiments and production.</p>
+ <p>We also aim to set new standards for sustainability in hardware, ensuring that our designs minimize material waste and energy consumption. Through iterative design and feedback loops with industry experts via our iHP (Integrated Human Practices) process, we ensure that our hardware not only meets the needs of today’s synthetic biology challenges but is also adaptable for future advancements. Ultimately, our goal is to make scalable, efficient, and environmentally conscious hardware accessible to researchers and manufacturers alike.</p>
</div>
<Panel client:load />
<div style="margin-top: 150px;">
diff --git a/src/pages/hardware/microfluidic-chip.mdx b/src/pages/hardware/microfluidic-chip.mdx
index fda16981eee559382c22acb280782e4810ea1010..5d76d09c2860307d88ccad1e5d04cd4456012c6d 100644
--- a/src/pages/hardware/microfluidic-chip.mdx
+++ b/src/pages/hardware/microfluidic-chip.mdx
@@ -850,7 +850,7 @@ description: Microfluidic Design Process
<img src="https://static.igem.wiki/teams/5228/hardware/microfluidicspage/20241001-microfluidic-lps-test-2-cy3.png" alt="Figure 29. LPS using ThTdT with dTTP and primer P2. Reaction manifolds: - not used; T thermocycler; M: microfluidic chip." style={{ width: '100%', height: 'auto', display: 'block' }}/>
<figcaption style={{paddingTop: '15px'}}>Figure 29. LPS using ThTdT with dTTP and primer P2. Reaction manifolds: - not used; T thermocycler; M: microfluidic chip.</figcaption>
</figure>
- <p>We learned that blocking the microfluidic chip with plasmids appears successful compared with the unblocked results in [2024.09.29 - Microfluidic Chip LPS Experiments](https://www.notion.so/2024-09-29-Microfluidic-Chip-LPS-Experiments-113d65dd82be8044a774fe335ec2f935?pvs=21).<br/>Regretfully, ThTdT activity was not observed across all reaction manifolds. The efficacy of ThTdT in microfluidic chips remains inconclusive in this entry, and warrants future studies.</p>
+ <p>We learned that blocking the microfluidic chip with plasmids appears successful compared with the unblocked results in [2024.09.29 - Microfluidic Chip LPS Experiments](/ubc-vancouver/notebook#2024-09-29-microfluidicchipexp).<br/>Regretfully, ThTdT activity was not observed across all reaction manifolds. The efficacy of ThTdT in microfluidic chips remains inconclusive in this entry, and warrants future studies.</p>
</details>
</details>
<br /><br/>
diff --git a/src/pages/ihp/cheung.md b/src/pages/ihp/cheung.md
deleted file mode 100644
index 986a2bf1257d3ded578f58db355d3720cbd592d9..0000000000000000000000000000000000000000
--- a/src/pages/ihp/cheung.md
+++ /dev/null
@@ -1,14 +0,0 @@
----
-title: 'TBD'
-date: 2024-08-01
-category: ["hardware"]
-link: TBD
----
-
-### Background
-
-### Interivew
-
-### Reflection
-
-### Intervention
\ No newline at end of file
diff --git a/src/pages/ihp/folch.md b/src/pages/ihp/folch.md
deleted file mode 100644
index 11435d7875395eabfe720606a0c4d7d0b9f01b42..0000000000000000000000000000000000000000
--- a/src/pages/ihp/folch.md
+++ /dev/null
@@ -1,13 +0,0 @@
----
-title: 'TBD'
-date: 2024-08-01
-category: ["hardware"]
-link: TBD
----
-### Background
-
-### Interivew
-
-### Reflection
-
-### Intervention
\ No newline at end of file
diff --git a/src/styles/header.scss b/src/styles/header.scss
index 2be244b3a301062eb1e9224abce34a6dffe183b4..9e985d647b71c50cff9097eaab85f827d2a1fa71 100644
--- a/src/styles/header.scss
+++ b/src/styles/header.scss
@@ -63,10 +63,10 @@ nav {
.menu {
position: fixed;
- width: 902px;
+ width: 942px;
height: 400px;
padding: 10px;
- right: 55px;
+ right: 25px;
top: 190px;
display: flex;
flex-direction: row;
diff --git a/src/styles/notebook.scss b/src/styles/notebook.scss
index 7a4a40979715485962f962e7602d617bec065529..8f8dce0f5bd779a93e607121ac06d54852a2d688 100644
--- a/src/styles/notebook.scss
+++ b/src/styles/notebook.scss
@@ -3,7 +3,7 @@
margin: auto;
img {
- width: 30vw;
+ width: 45vw;
height: auto;
object-fit: contain;
}