
Coding
Part:BBa_K1159004
Designed by: TU Munich 2013 Group: iGEM13_TU-Munich (2013-09-14)
Human protein phosphatase 1 (PP1) in RFC[25]
Human protein phosphatase 1 binds the toxic oligopeptide produces by gree-blue algae. This part is flanked by RFC[25] pre- and suffix.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 537
Illegal BamHI site found at 1 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 924
Protein data table for BioBrick BBa_ automatically created by the BioBrick-AutoAnnotator version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Nucleotide sequence in RFC 25 N-Part using the stop codon in the suffix, so ACCGGT was added (in italics) to the 3' end: (underlined part encodes the protein) GGATCCGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGC ... TTCAGGAGAACCGGT ORF from nucleotide position 83 to 106 (excluding stop-codon) | ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
| ||||||||||||||||||||||||||||||||||||||||||||||
Sequence features: (with their position in the amino acid sequence, see the list of supported features)
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid composition:
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid counting
| Biochemical parameters
| |||||||||||||||||||||||||||||||||||||||||||||
Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges | ||||||||||||||||||||||||||||||||||||||||||||||
Codon usage
| ||||||||||||||||||||||||||||||||||||||||||||||
Alignments (obtained from PredictProtein.org) There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
Predictions (obtained from PredictProtein.org) | ||||||||||||||||||||||||||||||||||||||||||||||
There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours. | ||||||||||||||||||||||||||||||||||||||||||||||
The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment. |
[edit]
Categories
Parameters
None |