From afd9fdf2967a051d64e89ceea0dec09aa0425d90 Mon Sep 17 00:00:00 2001 From: georgeandr <giorgosandronikidis@hotmail.com> Date: Fri, 14 Oct 2022 04:14:49 +0300 Subject: [PATCH] pre-pre-pre final --- pages/model.vue | 46 +++++++++++++++++++++++++++++++++------------- 1 file changed, 33 insertions(+), 13 deletions(-) diff --git a/pages/model.vue b/pages/model.vue index 96fe789..6b8b8af 100644 --- a/pages/model.vue +++ b/pages/model.vue @@ -1,7 +1,7 @@ <template> <div> <Header :title="currentPage"> - <div class="bg" style="background: url('https://static.igem.wiki/teams/4118/wiki/website-assets/collaborations/results123.jpg') center center no-repeat; background-size: cover;"> + <div class="bg" style="background: url('https://static.igem.wiki/teams/4118/wiki/website-assets/model.jpg') center center no-repeat; background-size: cover;"> <h1 class="head-title">{{currentPage}}</h1> </div> </Header> @@ -51,13 +51,13 @@ <a width="100%" href="https://static.igem.wiki/teams/4118/wiki/website-assets/model/fig2-step1.png"><img src="https://static.igem.wiki/teams/4118/wiki/website-assets/model/fig2-step1.png"/></a> <figcaption class="figure-caption text-left"><span>Fig.2:</span> Reaction breakdown of BSJ recognition by the H1 hairpin probe</figcaption> </figure> - </div><br> + </div> <br> <p>As shown in <span>Fig.1</span>, H1 consists of five domains c, b*, a, b, and r. Without the BSJ-target in the reaction mixture, H1 exists in a stem-loop conformation. The two complementary domains b and b* form the H1-stem. H1-loop consists of domain α. Η1 also possesses two different overhang regions, r, responsible for the hybridization with the RCA product through complementarity, and c, a toehold domain. The BSJ of the circRNA-target is complementary to the b and c domains. </p> <p>As shown in <span>Fig.2</span>, the first reaction includes two steps: BSJ binds to H1 via invading the toehold c and displaces the b* domain by branch migration.</p> <p>The rate k<sub>f1</sub> denotes the hybridization rate of c to its complement. The base composition of the c domain can cause the value of k<sub>f1</sub> to vary significantly. </p> <p>The rate k<sub>b1</sub> denotes the rate at which the branch migration junction crosses the middle of the b domain. As the incumbent, b*, and invader, BSJ, exchange base pairs with the substrate, b, the branch point of the three-stranded complex moves back and forth. Eventually, the b* domain dissociates, completing strand displacement. Overall, displacement is thermodynamically driven forward by the net gain in base pairs due to the toehold. The length of the b domain determines the value of k<sub>b1</sub>. Finally, k<sub>r1</sub> denotes the rate at which toehold c dissociates. The binding of c to its complement is reversible because the toehold may ‘fray’ and eventually dissociate.</p> - <p>k<sub>r1</sub> = k<sub>f1</sub>·(2/b)·e<sup>ΔG<sub>o</sub>(c)/RT</sup> [I]</p> - <p>where ΔG<sub>o</sub>(c) < 0 is the binding energy between c and its complement, and b the length of b domain <a v-scroll-to="'#references'" class="link-ref">[1]</a>.</p> + <p style="text-align: center;">k<sub>r1</sub> = k<sub>f1</sub>·(2/b)·e<sup>ΔG<sup>o</sup>(c)/RT</sup> [I]</p> + <p>where ΔG<sup>o</sup>(c) < 0 is the binding energy between c and its complement, and b the length of b domain <a v-scroll-to="'#references'" class="link-ref">[1]</a>.</p> </section> <section> <h3 class="small-title">2<sup>nd</sup> toehold-mediated strand displacement reaction</h3> @@ -74,13 +74,21 @@ <p>As depicted in <span>Fig.3</span>, H2 also consists of five domains a*, b, a, b*, and r. Initially, H2 forms a stem-loop conformation by hybridizing the two complementary domains, b and b*. The formed loop consists of domain l. Like H1, the H2 hairpin possesses two overhang regions: a toehold domain, a* domain, and an RCA binding domain, s domain. In addition, H2 brings a fluorophore and a quencher. We represent them in Fig3 as a green and a black dot, respectively.</p> <p>The second toehold reaction is illustrated in <span>Fig.4</span>. Toehold domain a* binds to H1’s complementary domain a. After the toehold invasion, branch migration displacement occurs. The H1 b domain displaces the stem b domain. H2 now exists in an open conformation, which results in the fluorophore diverging from the quencher and emitting fluorescence when excited at the right wavelength. </p> <p>As in step 1, the rate k<sub>f2</sub> represents the hybridization rate of toehold domain a* to its complement. In addition, the rate k<sub>b2</sub> denotes the rate at which the branch migration junction crosses the middle of the b domain. Finally, k<sub>r2</sub> denotes the rate at which toehold a* frays and dissociates. </p> - <p>k<sub>r2</sub> = k<sub>f2</sub>·(2/b)·e<sup>ΔG<sub>o</sub>(c)/RT</sup> [II]</p> - <p>where ΔG<sub>o</sub>(a) < 0 is the binding energy between a and its complement, and b the length of b domain.</p> + <p style="text-align: center;">k<sub>r2</sub> = k<sub>f2</sub>·(2/b)·e<sup>ΔG<sup>o</sup>(a)/RT</sup> [II]</p> + <p>where ΔG<sup>o</sup>(a) < 0 is the binding energy between a and its complement, and b the length of b domain.</p> </section> <section> <h3 class="small-title">KinDA: Kinetic DNA strand displacement analyzer</h3> <p>KinDA <a v-scroll-to="'#references'" class="link-ref">[2]</a> is a python package that can predict system <a @click="changeWord('Thermodynamics-kinetics')" class="link-primary">kinetic and thermodynamic behavior</a> at the sequence level. With KinDA, we can determine if the system as a whole behaves as designed. We tested KinDA through the available Amazon Web Services (AWS) Amazon Machine Image (AMI).</p> <p>First, the user creates a PIL file that specifies the domains, as described above, stands, and complexes of the DNA strand-displacement system. An example of the user input is the following</p> + <p><span>#0102533_step1.pil</span><br><br> + + <span># Specify all domains</span><br> + sequence c = CTGTAATCGC : 10<br> + sequence b = TCACTCTGGATTTCTATCAA : 20<br> + sequence a = GACATCTACCAACA : 14<br> + sequence r = CTCATACCATAT : 12<br> + sequence s = TTGCCATGAAAAAGAAAAACTTCCGGATAAGAAAGAAAA : 39</p> <p><span># Specify all strands:</span> <br>strand h1 = c b a b* r : 76 <br>strand bsj = b* c* : 30 @@ -108,14 +116,26 @@ </section> <section> <h3 class="small-title">The results</h3> - <p>Modifying a MATLAB script provided by our partners, MetaThess team, we simulated our KinDA results. The plot for hsa_circ_0102533 is depicted on fig.5. The equations for the simulated reactions are the following:</p> - <p>[H1-closed] = - k<sub>1(i)</sub> [H1-closed][BSJ] - <br>[BSJ] = - k<sub>1(i)</sub> [H1-closed][BSJ] - <br>[H1-open] = k<sub>1(i)</sub> [H1][BSJ] - k<sub>1(ii)</sub>[H2-closed][H1-open] - <br>[H2-closed] = - k<sub>1(ii)</sub>[H2-closed][H1-open] - <br>[H2-open] = k<sub>1(ii)</sub>[H2-closed][H1-open] + <p>Modifying a MATLAB script provided by our partners, the Thessaloniki_Meta team, we simulated our KinDA results. The plot for hsa_circ_0102533 is depicted in Fig.5. The equations for the simulated reactions are the following:</p> + <p>[H1-closed]/dt = - k<sub>1(i)</sub> [H1-closed][BSJ] + <br>[BSJ]/dt = - k<sub>1(i)</sub> [H1-closed][BSJ] + <br>[H1-open]/dt = k<sub>1(i)</sub> [H1][BSJ] - k<sub>1(ii)</sub>[H2-closed][H1-open] + <br>[H2-closed]/dt = - k<sub>1(ii)</sub>[H2-closed][H1-open] + <br>[H2-open]/dt = k<sub>1(ii)</sub>[H2-closed][H1-open] </p> - <p>The initial concentrations of [H1-closed] and [H2-closed] in the simulation correspond to H1 and H2 probes hybridized on the linear scaffold in their closed conformation, and are the experimental ones. We run a script using multiple target concentrations, [BSJ]. We observe that [H2-open] increases with time for all given [BSJ] concentrations. Also, [H2-open] maximum concentration increases with [BSJ]. This is crucial because [H2-open] determines the fluorescence emitted, which confirms our laboratory results.</p> + <p>The initial concentrations of [H1-closed] and [H2-closed] in the simulation correspond to H1, and H2 probes hybridized on the linear scaffold in their closed conformation. We run a script using multiple target concentrations, [BSJ]. We used 42.000 sec as our simulation time, the same as the experimental. We observe that [H2-open] increases with time for all given [BSJ] concentrations. Also, [H2-open] maximum concentration increases with [BSJ]. It is crucial because [H2-open] determines the response signal, confirming our laboratory results.</p> + <div class="row gallery"> + <figure class="col-xs-12 col-xl-6 align-self-xl-center"> + <a width="100%" href="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/pic1.jpg"><img src="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/pic1.jpg"/></a> + </figure> + <figure class="col-xs-12 col-xl-6 align-self-xl-center"> + <a width="100%" href="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/all-x-for-ye-3e-12.jpg"><img src="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/all-x-for-ye-3e-12.jpg"/></a> + </figure> + <figcaption class="figure-caption text-left"><span>Fig.5:</span> Concentrations of H1 and H2 in their open and closed conformations during 70 min for BSJ target concentrations 1.5e-12 (Left) and 3e-12 M (Right)</figcaption> + </div> + <figure class="gallery"> + <a href="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/x5-concetration.jpg"><img src="https://static.igem.wiki/teams/4118/wiki/parts/mat-lab/x5-concetration.jpg"></a> + </figure> </section> </section> <section id="biomarker"> -- GitLab