{% extends "layout.html" %} {% block title %}Notebook{% endblock %} {% block page_content %}
Time: 7:00
Member: Ms. Crissy
What: Aptamer Resuspension
S2.2: GCAGTTGATCCTTTGGATACCCTGG
1. Before open the container, always briefly SPIN DOWN for the first time after delivery to avoid loss of the aptamer pellet. Briefly centrifuge the aptamer tube to ensure the dried aptamer pellet is at the bottom
2. Dissolve the stock aptamers completely to the desired stock concentration with buffers by shaking. Use buffer shown above. The recommended diluent volume is 100ul. The concentration depending on your application and the yield of the resulting product. Resuspend the aptamer pellet in Aptamer Resuspension Buffer using the volume indicated in the Packing Slip that was included in your aptamer shipment. Quickly spin the sample down (>1000 x g for a few seconds)
3. Aliquot and store stock aptamers at -20°C to -70°C until you use it. Make a stock solution and working aliquots which should be thawed relatively infrequently.
4. Before every use, perform Heating & cooling (H&C) step for the PROPER FOLDING of aptamer structure in buffer including 1~5mM MgCl2 2. Please heat aptamers in proper buffer solution at 95 C for 5 min (in PCR machine), and then leave the tubes on the bench for 15 min.
5. Prior to use, dilute the aptamer to 10 - 100x working concentration in buffer shown above. Heat the aptamer solution to 90-95°C for 5 minutes
6. Allow the aptamer solution to cool to room temperature (~15 minutes). Aptamers are conformationally stable for at least one week at room temperature unless the salt or temperature is significantly changed (falls below 0°C or rises above 30°C).
7. The aptamer can now be further diluted into the final working buffer for your specific application, or Application Buffer. Please use 100 mM NaCl, 5 mM MgCl2, pH 7.2 in Tris or Hepes buffer.
Time: 8:00-17:00
Member: Kai
Members: Kai, Koharu, Annmarie, Rui, Hana
What: FRET verification through various protocols
diluting aptamer and biomarker solutions to the intended concentrations
test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
Time: 7:00
Member: Ms. Crissy
What: Aptamer Resuspension
S2.2: GCAGTTGATCCTTTGGATACCCTGG
1. Before open the container, always briefly SPIN DOWN for the first time after delivery to avoid loss of the aptamer pellet. Briefly centrifuge the aptamer tube to ensure the dried aptamer pellet is at the bottom
2. Dissolve the stock aptamers completely to the desired stock concentration with buffers by shaking. Use buffer shown above. The recommended diluent volume is 100ul. The concentration depending on your application and the yield of the resulting product. Resuspend the aptamer pellet in Aptamer Resuspension Buffer using the volume indicated in the Packing Slip that was included in your aptamer shipment. Quickly spin the sample down (>1000 x g for a few seconds)
3. Aliquot and store stock aptamers at -20°C to -70°C until you use it. Make a stock solution and working aliquots which should be thawed relatively infrequently.
4. Before every use, perform Heating & cooling (H&C) step for the PROPER FOLDING of aptamer structure in buffer including 1~5mM MgCl2 2. Please heat aptamers in proper buffer solution at 95 C for 5 min (in PCR machine), and then leave the tubes on the bench for 15 min.
5. Prior to use, dilute the aptamer to 10 - 100x working concentration in buffer shown above. Heat the aptamer solution to 90-95°C for 5 minutes
6. Allow the aptamer solution to cool to room temperature (~15 minutes). Aptamers are conformationally stable for at least one week at room temperature unless the salt or temperature is significantly changed (falls below 0°C or rises above 30°C).
7. The aptamer can now be further diluted into the final working buffer for your specific application, or Application Buffer. Please use 100 mM NaCl, 5 mM MgCl2, pH 7.2 in Tris or Hepes buffer.
Time: 8:00-17:00
Member: Kai
Members: Kai, Koharu, Annmarie, Rui, Hana
What: FRET verification through various protocols, diluting aptamer and biomarker solutions to the intended concentrations
test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
(We realized yesterday that we forgot to use the buffer used for the aptamer probes to dilute with)
Time: 15:00-17:00
Member: Kai
Members: Kai, Julia
What: FRET verification through serial dilution
Our reordered aptamers finally came
Diluting aptamer and biomarker solutions to the intended concentrations
Test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
We realized yesterday that we forgot to use the buffer used for the aptamer probes to dilute with
Time: 16:00-17:00
Member: Koharu
Members: Koharu, Shun
What: ELISA Assay
Time: 16:00-17:00
Member: Kai
Members: Kai, Shun, JonJon
ELISA Assay
Time: 10:30-16:30
Member: Annmarie
Members: Annmarie, Kai, Koharu
ELISA Assay
Time: 15:00-16:00
Member: Kai
Members: Kai, Rui, Sara
What: Shelf-llife Test and Specificity Test